ID: 1200649044

View in Genome Browser
Species Human (GRCh38)
Location Y:5817957-5817979
Sequence GTGTGTTTCTAGAAATGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200649041_1200649044 9 Left 1200649041 Y:5817925-5817947 CCCTTCAAGGCAGCAGGTTTTCT No data
Right 1200649044 Y:5817957-5817979 GTGTGTTTCTAGAAATGTCCAGG No data
1200649038_1200649044 25 Left 1200649038 Y:5817909-5817931 CCAGGACTTGGTTCTTCCCTTCA 0: 5
1: 35
2: 214
3: 455
4: 822
Right 1200649044 Y:5817957-5817979 GTGTGTTTCTAGAAATGTCCAGG No data
1200649042_1200649044 8 Left 1200649042 Y:5817926-5817948 CCTTCAAGGCAGCAGGTTTTCTT No data
Right 1200649044 Y:5817957-5817979 GTGTGTTTCTAGAAATGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200649044 Original CRISPR GTGTGTTTCTAGAAATGTCC AGG Intergenic
No off target data available for this crispr