ID: 1200649045

View in Genome Browser
Species Human (GRCh38)
Location Y:5817964-5817986
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200649041_1200649045 16 Left 1200649041 Y:5817925-5817947 CCCTTCAAGGCAGCAGGTTTTCT No data
Right 1200649045 Y:5817964-5817986 TCTAGAAATGTCCAGGATCTAGG No data
1200649042_1200649045 15 Left 1200649042 Y:5817926-5817948 CCTTCAAGGCAGCAGGTTTTCTT No data
Right 1200649045 Y:5817964-5817986 TCTAGAAATGTCCAGGATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200649045 Original CRISPR TCTAGAAATGTCCAGGATCT AGG Intergenic
No off target data available for this crispr