ID: 1200663287

View in Genome Browser
Species Human (GRCh38)
Location Y:5987990-5988012
Sequence AAAGGGAGACTATACTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200663281_1200663287 18 Left 1200663281 Y:5987949-5987971 CCTTTGATTAGATTACTAATCAG No data
Right 1200663287 Y:5987990-5988012 AAAGGGAGACTATACTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200663287 Original CRISPR AAAGGGAGACTATACTGGGT GGG Intergenic
No off target data available for this crispr