ID: 1200663530

View in Genome Browser
Species Human (GRCh38)
Location Y:5991232-5991254
Sequence CAAGCTACTTTCCGTGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200663530_1200663531 17 Left 1200663530 Y:5991232-5991254 CCTTTTTCACGGAAAGTAGCTTG No data
Right 1200663531 Y:5991272-5991294 GCTTCCTGCCAGTAGAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200663530 Original CRISPR CAAGCTACTTTCCGTGAAAA AGG (reversed) Intergenic
No off target data available for this crispr