ID: 1200667756

View in Genome Browser
Species Human (GRCh38)
Location Y:6048490-6048512
Sequence TAGGGTCAACTGTTGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200667756_1200667762 -3 Left 1200667756 Y:6048490-6048512 CCCACCACCAACAGTTGACCCTA No data
Right 1200667762 Y:6048510-6048532 CTAATTTAAACTATGTACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200667756 Original CRISPR TAGGGTCAACTGTTGGTGGT GGG (reversed) Intergenic
No off target data available for this crispr