ID: 1200678998 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:6186196-6186218 |
| Sequence | GTTTCATTGCTGAAAGTGGG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1200678998_1200679004 | 19 | Left | 1200678998 | Y:6186196-6186218 | CCCCCCACTTTCAGCAATGAAAC | No data | ||
| Right | 1200679004 | Y:6186238-6186260 | AGAAAAAAAAATAAGAAACATGG | No data | ||||
| 1200678998_1200679005 | 20 | Left | 1200678998 | Y:6186196-6186218 | CCCCCCACTTTCAGCAATGAAAC | No data | ||
| Right | 1200679005 | Y:6186239-6186261 | GAAAAAAAAATAAGAAACATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1200678998 | Original CRISPR | GTTTCATTGCTGAAAGTGGG GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||