ID: 1200678998

View in Genome Browser
Species Human (GRCh38)
Location Y:6186196-6186218
Sequence GTTTCATTGCTGAAAGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200678998_1200679004 19 Left 1200678998 Y:6186196-6186218 CCCCCCACTTTCAGCAATGAAAC No data
Right 1200679004 Y:6186238-6186260 AGAAAAAAAAATAAGAAACATGG No data
1200678998_1200679005 20 Left 1200678998 Y:6186196-6186218 CCCCCCACTTTCAGCAATGAAAC No data
Right 1200679005 Y:6186239-6186261 GAAAAAAAAATAAGAAACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200678998 Original CRISPR GTTTCATTGCTGAAAGTGGG GGG (reversed) Intergenic
No off target data available for this crispr