ID: 1200679004

View in Genome Browser
Species Human (GRCh38)
Location Y:6186238-6186260
Sequence AGAAAAAAAAATAAGAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200679001_1200679004 16 Left 1200679001 Y:6186199-6186221 CCCACTTTCAGCAATGAAACAAT No data
Right 1200679004 Y:6186238-6186260 AGAAAAAAAAATAAGAAACATGG No data
1200678999_1200679004 18 Left 1200678999 Y:6186197-6186219 CCCCCACTTTCAGCAATGAAACA No data
Right 1200679004 Y:6186238-6186260 AGAAAAAAAAATAAGAAACATGG No data
1200679002_1200679004 15 Left 1200679002 Y:6186200-6186222 CCACTTTCAGCAATGAAACAATT No data
Right 1200679004 Y:6186238-6186260 AGAAAAAAAAATAAGAAACATGG No data
1200679000_1200679004 17 Left 1200679000 Y:6186198-6186220 CCCCACTTTCAGCAATGAAACAA No data
Right 1200679004 Y:6186238-6186260 AGAAAAAAAAATAAGAAACATGG No data
1200678998_1200679004 19 Left 1200678998 Y:6186196-6186218 CCCCCCACTTTCAGCAATGAAAC No data
Right 1200679004 Y:6186238-6186260 AGAAAAAAAAATAAGAAACATGG No data
1200679003_1200679004 -10 Left 1200679003 Y:6186225-6186247 CCAGAGAGAAAGAAGAAAAAAAA No data
Right 1200679004 Y:6186238-6186260 AGAAAAAAAAATAAGAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200679004 Original CRISPR AGAAAAAAAAATAAGAAACA TGG Intergenic
No off target data available for this crispr