ID: 1200683145

View in Genome Browser
Species Human (GRCh38)
Location Y:6236326-6236348
Sequence AAGTGTGGCCAAATGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200683145_1200683153 23 Left 1200683145 Y:6236326-6236348 CCCACTTCCATTTGGCCACACTT No data
Right 1200683153 Y:6236372-6236394 GTAAGGCTCAAAACCTTGGTAGG No data
1200683145_1200683152 19 Left 1200683145 Y:6236326-6236348 CCCACTTCCATTTGGCCACACTT No data
Right 1200683152 Y:6236368-6236390 CAGAGTAAGGCTCAAAACCTTGG No data
1200683145_1200683149 6 Left 1200683145 Y:6236326-6236348 CCCACTTCCATTTGGCCACACTT No data
Right 1200683149 Y:6236355-6236377 TCTGCCACAGCCTCAGAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200683145 Original CRISPR AAGTGTGGCCAAATGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr