ID: 1200684243

View in Genome Browser
Species Human (GRCh38)
Location Y:6245493-6245515
Sequence GCTTCCAGAGCCCCACCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200684239_1200684243 -4 Left 1200684239 Y:6245474-6245496 CCAGAGGCCGAGGCCCTGTGCTT No data
Right 1200684243 Y:6245493-6245515 GCTTCCAGAGCCCCACCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200684243 Original CRISPR GCTTCCAGAGCCCCACCAGC AGG Intergenic
No off target data available for this crispr