ID: 1200684772

View in Genome Browser
Species Human (GRCh38)
Location Y:6248270-6248292
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 9, 1: 1, 2: 3, 3: 6, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200684768_1200684772 6 Left 1200684768 Y:6248241-6248263 CCTTGAGAGGAAGACAGAGAGTG 0: 8
1: 5
2: 4
3: 50
4: 427
Right 1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG 0: 9
1: 1
2: 3
3: 6
4: 69
1200684766_1200684772 27 Left 1200684766 Y:6248220-6248242 CCTTTCGTACATGTAGAAATTCC 0: 9
1: 4
2: 2
3: 9
4: 76
Right 1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG 0: 9
1: 1
2: 3
3: 6
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type