ID: 1200686456

View in Genome Browser
Species Human (GRCh38)
Location Y:6263948-6263970
Sequence CAGATCAAGGAGAAAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 853
Summary {0: 1, 1: 9, 2: 5, 3: 82, 4: 756}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200686449_1200686456 4 Left 1200686449 Y:6263921-6263943 CCGGGATGGCTGAGTTCCTCCAC 0: 11
1: 6
2: 3
3: 13
4: 138
Right 1200686456 Y:6263948-6263970 CAGATCAAGGAGAAAGAGGATGG 0: 1
1: 9
2: 5
3: 82
4: 756
1200686448_1200686456 11 Left 1200686448 Y:6263914-6263936 CCGGTAACCGGGATGGCTGAGTT 0: 8
1: 3
2: 12
3: 13
4: 121
Right 1200686456 Y:6263948-6263970 CAGATCAAGGAGAAAGAGGATGG 0: 1
1: 9
2: 5
3: 82
4: 756
1200686445_1200686456 18 Left 1200686445 Y:6263907-6263929 CCTGCCACCGGTAACCGGGATGG 0: 9
1: 0
2: 2
3: 8
4: 51
Right 1200686456 Y:6263948-6263970 CAGATCAAGGAGAAAGAGGATGG 0: 1
1: 9
2: 5
3: 82
4: 756
1200686447_1200686456 14 Left 1200686447 Y:6263911-6263933 CCACCGGTAACCGGGATGGCTGA 0: 8
1: 1
2: 4
3: 7
4: 38
Right 1200686456 Y:6263948-6263970 CAGATCAAGGAGAAAGAGGATGG 0: 1
1: 9
2: 5
3: 82
4: 756

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200686456 Original CRISPR CAGATCAAGGAGAAAGAGGA TGG Intergenic
900007257 1:69260-69282 CAGATCAATGAGTGAGAGGTTGG - Exonic
900170253 1:1264429-1264451 CAGAGCAAGGGGAAAGATGATGG - Intronic
900932879 1:5747793-5747815 GAGAGAAAGGAGAAAGAGGGAGG + Intergenic
902613724 1:17612332-17612354 CAGATGAAGGAATAAGAGGATGG - Intronic
903286183 1:22278179-22278201 GAGATAAAAGAGAGAGAGGAAGG + Intergenic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
903443581 1:23406426-23406448 CAGATCAAGGAGAACGATTAGGG - Intronic
903959885 1:27050227-27050249 CAGATACAGGAGAAGGTGGAGGG + Intergenic
904068896 1:27777528-27777550 CAGTACAAGGGGAAAGAGGCAGG - Intronic
904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG + Intronic
905030238 1:34877475-34877497 CTGAACCAGGAGAAAGAAGAGGG + Intronic
905934066 1:41809810-41809832 CAGATGAAAGAAAAAGGGGAAGG + Intronic
906387232 1:45380644-45380666 CAGAGCAAAGAGAAAGAATAAGG + Intronic
906822563 1:48944727-48944749 TTGATCAAGAAGAAAGGGGAAGG - Intronic
907712631 1:56898454-56898476 CAAATCAAGGAGAAAGAGTATGG - Intronic
907874965 1:58476870-58476892 CAGTACATGGAGGAAGAGGACGG + Intronic
908634025 1:66142170-66142192 CAGGTTGAGGAGGAAGAGGAAGG + Intronic
908641029 1:66223711-66223733 CAGTGCATAGAGAAAGAGGAGGG + Intronic
908677303 1:66619650-66619672 CAGGACAAGGAGAGAAAGGAGGG + Intronic
909286840 1:73830275-73830297 CAGAAAAAGGAGAGAGGGGAAGG + Intergenic
909419230 1:75444933-75444955 GAGATTGAGGAGAAAGAAGAAGG + Intronic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910156133 1:84222562-84222584 CACATAAATGAGAAAGAGAAAGG - Intronic
910161852 1:84280890-84280912 AAAAGAAAGGAGAAAGAGGAAGG - Intergenic
910162550 1:84289432-84289454 CATCTCAAAGAGACAGAGGAAGG - Intergenic
910238020 1:85055805-85055827 CGGAGAAAGGAGAATGAGGAAGG + Intronic
910799774 1:91133428-91133450 AAGTTCCAGGAGAAAAAGGAGGG - Intergenic
911404532 1:97420180-97420202 CAGATCAGAGAGACTGAGGAGGG - Intronic
911782455 1:101899376-101899398 CAGATGAAAGAGGGAGAGGAGGG + Intronic
912151172 1:106860536-106860558 GAGATAAAGGAGAAAGCTGATGG - Intergenic
912588235 1:110786997-110787019 AAGCTCAAAGAGAAAGAGAAAGG + Intergenic
913085168 1:115430113-115430135 CAGAGAATGGAGAAAGAGAATGG - Intergenic
913453700 1:119009395-119009417 TAGAGAAAGGAGAAAGATGAAGG + Intergenic
913565219 1:120066992-120067014 GAAAACAAGGAGCAAGAGGATGG + Intronic
913591874 1:120336814-120336836 AAGGTCCAGGAGAAAGAGGAAGG + Intergenic
913632911 1:120726567-120726589 GAAAACAAGGAGCAAGAGGATGG - Intergenic
913651482 1:120918332-120918354 AAGGTCCAGGAGAAAGAGGAAGG - Intergenic
914169627 1:145210738-145210760 AAGGTCCAGGAGAAAGAGGAAGG + Intergenic
914524740 1:148454700-148454722 AAGGTCCAGGAGAAAGAGGAAGG + Intergenic
914598934 1:149181133-149181155 AAGGTCCAGGAGAAAGAGGAAGG - Intergenic
914619724 1:149393570-149393592 GAAAACAAGGAGCAAGAGGATGG - Intergenic
914641660 1:149612435-149612457 AAGGTCCAGGAGAAAGAGGAAGG - Intergenic
914863632 1:151407114-151407136 CAGAAAAAGGAGAAAGTGGGAGG - Intronic
914906939 1:151754115-151754137 CAGATCTTGGAGAATGAGTATGG + Intergenic
914950630 1:152110653-152110675 CAGCTCCAGGAGGAGGAGGACGG - Exonic
915735508 1:158082120-158082142 CAGAACAAGGAGGAAGAGCCAGG + Intronic
915865669 1:159495348-159495370 GAGAGCAAGCAGAAACAGGATGG - Intergenic
915952575 1:160199221-160199243 CTGAGCAAGGGGAAACAGGACGG + Intronic
916593633 1:166219781-166219803 CACACAAAGGAGAAAGAGAAAGG - Intergenic
916837589 1:168563918-168563940 CAGAACAATGAGAAATAGGCGGG + Intergenic
916942399 1:169689512-169689534 CACATCACGGAGACAGAGGCAGG + Intronic
917243695 1:172976818-172976840 CAGGTCAAGGACAAGGTGGAGGG + Intergenic
917704683 1:177620121-177620143 GAGATCAAAAAGGAAGAGGAAGG - Intergenic
918038250 1:180896195-180896217 CAGATCAGGGATAAGGAGGCTGG + Intergenic
918421074 1:184364641-184364663 CAGATCAAGGAGACAGGGAGAGG + Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
918754437 1:188319918-188319940 CAGGTACAGGAGACAGAGGAGGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919970377 1:202572956-202572978 CAGATCAAGGTGAAAGAATTTGG - Intronic
920176057 1:204102619-204102641 CAGATGGAGGAGGAAGAGGGTGG + Intronic
920228201 1:204453111-204453133 CAGATTAAAGAGACTGAGGAGGG - Intronic
920402005 1:205681786-205681808 CAGAGCCAGGAGAGAGTGGACGG + Intergenic
920457871 1:206114878-206114900 CAGAAGCAGGATAAAGAGGAGGG + Intronic
920625932 1:207598954-207598976 GTGCTCAGGGAGAAAGAGGATGG + Intronic
920690973 1:208146059-208146081 CAGGTCAAGGAGAAAAAGGTGGG + Intronic
921787220 1:219245074-219245096 AAGAGAAAGAAGAAAGAGGAAGG - Intergenic
921841685 1:219835333-219835355 CAGGTCAAGCTGAAAGAGGATGG - Intronic
922535818 1:226379915-226379937 CAGGTCAAGGAGGAAGGTGAGGG - Exonic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
922894342 1:229088771-229088793 CAAGGTAAGGAGAAAGAGGAGGG + Intergenic
922939821 1:229452865-229452887 CACAGCAACGAGAAATAGGAGGG + Intronic
923939572 1:238806613-238806635 CAGATCAAAGGAAAAGATGATGG + Intergenic
924657337 1:245984899-245984921 CAGAGCAAGGAGAAGTCGGATGG - Intronic
924867155 1:247996087-247996109 CAGCTGAAGGAGGAAGAGGAAGG - Intronic
924871054 1:248044880-248044902 CAGCTGAAGGAGGAAGAGAAAGG - Intronic
1063623794 10:7671112-7671134 AACATTAAGGAGACAGAGGAAGG + Intergenic
1064448230 10:15416461-15416483 CAGATCAAGGAAAAGATGGAAGG + Intergenic
1064697018 10:17976895-17976917 CAGAGAAAGGAGAAAGAGAAAGG - Intronic
1065202296 10:23324756-23324778 CAGATCAAGGACAATAAAGAAGG - Intronic
1065664936 10:28048968-28048990 CATCTCAAGCAGAAAGATGAGGG + Intergenic
1066011574 10:31199145-31199167 GAGAAGGAGGAGAAAGAGGAAGG - Intergenic
1067512349 10:46906497-46906519 GAGAGCAAAGAGAAAGAGGATGG + Intergenic
1067649894 10:48145325-48145347 GAGAGCAAAGAGAAAGAGGATGG - Intergenic
1067780812 10:49205459-49205481 GAGCTCAAGGAGAGGGAGGAAGG - Intergenic
1068150261 10:53122336-53122358 CAGATCAACCAGAAAAATGAAGG + Intergenic
1068278801 10:54839557-54839579 CAGAAAAAGGAGAGAGAGAAGGG + Intronic
1068331450 10:55576358-55576380 CAGGCTGAGGAGAAAGAGGAAGG + Intronic
1068719419 10:60227509-60227531 CAGGCAAAGGAGAAAGAGAATGG - Intronic
1069837683 10:71319462-71319484 GAGAGCAAGGAGAGAGAGGAGGG - Intronic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070561106 10:77567101-77567123 CTGACCAAGGAGACAGAGCACGG + Intronic
1070637092 10:78137709-78137731 GAGAAAGAGGAGAAAGAGGAAGG - Intergenic
1071122531 10:82296203-82296225 CAGCTCAGAGAGGAAGAGGAAGG + Intronic
1071497564 10:86179316-86179338 GAGAGCAAGGAGAAAGATGGAGG - Intronic
1071835927 10:89416647-89416669 CAGCCCAAGGAGGATGAGGAGGG - Intronic
1072830195 10:98649264-98649286 AATAGAAAGGAGAAAGAGGAAGG + Intronic
1073402701 10:103271954-103271976 AAGATCAAGAAGCAAGGGGAGGG + Intergenic
1073514798 10:104066676-104066698 GAGATCAGGGAGTAACAGGAAGG + Intronic
1074702722 10:116106628-116106650 CAGAACCAAGAGAAAGTGGAGGG - Intronic
1075272188 10:121061909-121061931 CAGATCATGGAGGATGGGGAAGG + Intergenic
1075909353 10:126110489-126110511 AAGAGCAAAGAGAAAGAGAACGG + Intronic
1076023855 10:127096144-127096166 CAGAACAAAAAGAAAGACGATGG - Intronic
1076030137 10:127150336-127150358 CTGAGCAAAGAGAAAGGGGAGGG - Intronic
1077108021 11:850270-850292 CAGTTCTAGGAGGAAGATGAAGG - Exonic
1077763962 11:5136692-5136714 CAGATAAAGGAGATAGACAAGGG + Intergenic
1077844115 11:6006100-6006122 AAGATTAAGGAGACAGAGAAAGG + Intergenic
1078249721 11:9607141-9607163 CAGTTAAAGCAGAAAGTGGAGGG + Intergenic
1078357948 11:10646881-10646903 TAGCTGAAGGAGAATGAGGAAGG - Intronic
1078941428 11:16010675-16010697 GAGAGCAGAGAGAAAGAGGAGGG + Intronic
1079533917 11:21487532-21487554 CACACAAATGAGAAAGAGGAAGG + Intronic
1079929944 11:26545790-26545812 TAGAGCAAGGAGGAAGAGGGAGG - Intronic
1080709628 11:34734389-34734411 CTGAGCATGCAGAAAGAGGATGG - Intergenic
1082176283 11:49063802-49063824 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1082651528 11:55799846-55799868 CAGGTTATGGAGAAAAAGGAAGG + Intergenic
1082881407 11:58041529-58041551 CAGGGCAAGGAGAAAGAGCAGGG + Intronic
1084094592 11:66902706-66902728 CAGCTGGAGGAGGAAGAGGAGGG - Intronic
1085891777 11:80588140-80588162 CAGATTTATGAGAAAGACGAAGG + Intergenic
1086078880 11:82882122-82882144 CAGGAGGAGGAGAAAGAGGAGGG + Intronic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086138935 11:83472883-83472905 TGGTTCAAGGAGAAAGAGCAAGG - Intronic
1086221503 11:84450565-84450587 GAGATCAGGGAGAATGATGAAGG + Intronic
1086274124 11:85104905-85104927 GAGAGAAAGGAGAAAGAGGTGGG + Intronic
1086364809 11:86098137-86098159 CAGATTAGGAAAAAAGAGGAAGG + Intergenic
1086689435 11:89772064-89772086 GAGAAGGAGGAGAAAGAGGAGGG - Intergenic
1086716422 11:90067890-90067912 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1087307073 11:96500597-96500619 CAGCTGAATGAGAAGGAGGAGGG - Intronic
1087672848 11:101127893-101127915 AAGATAAAGGAGGAGGAGGAAGG - Exonic
1088068344 11:105749441-105749463 AAGATACAGGAGAAAGAGAAGGG + Intronic
1088134694 11:106540392-106540414 CAGAGCAGGAAGTAAGAGGAGGG - Intergenic
1088181655 11:107120180-107120202 CAGAAAAAGGAGAGAGAGTAAGG + Intergenic
1088184288 11:107147276-107147298 CAGATCTAGGAAAAAGGAGATGG + Intergenic
1088363498 11:109016141-109016163 TAGAGCAAGGAGCCAGAGGAAGG + Intergenic
1088532876 11:110829637-110829659 CAGATCAAGCAGGAAAAAGAAGG + Intergenic
1088610952 11:111576215-111576237 TAGATCAAGAAGAAAGAAAAGGG + Intergenic
1089126017 11:116177142-116177164 AAGATGTAGCAGAAAGAGGAGGG + Intergenic
1090096828 11:123750569-123750591 CAGATCCAAGAAAAGGAGGAAGG - Intergenic
1090234992 11:125140452-125140474 CAGAGCTCGGAGACAGAGGAGGG - Intergenic
1090667966 11:128927446-128927468 CAGAGCATGGACAGAGAGGAAGG + Intergenic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1092171580 12:6376656-6376678 GTGAGCAAGGAGAGAGAGGAGGG + Intronic
1092678897 12:10954817-10954839 AAGATCAAGAAGAAACAGAAGGG + Intronic
1092839329 12:12524030-12524052 CAGATCAAGGGACAAAAGGAGGG + Intronic
1092860063 12:12712609-12712631 CAAAGCAAGGAGAAAGAGGAAGG - Intergenic
1093091109 12:14921348-14921370 CAGATAAATGAGGATGAGGAAGG + Intronic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093688228 12:22080635-22080657 CAGATCAAGGGGTCAGAAGATGG + Intronic
1094201878 12:27803417-27803439 CTGATGGAGGAGAAGGAGGATGG + Intergenic
1094564513 12:31588048-31588070 AAGATCAAAGAGAAAGGGCAGGG - Intronic
1094778242 12:33757831-33757853 GAGCCCAAGGGGAAAGAGGAGGG - Intergenic
1095345552 12:41144822-41144844 GACCTCAAGGAGAAAGGGGAAGG - Intergenic
1095410294 12:41914117-41914139 AAGATAAAGGAGAATGAGAATGG + Intergenic
1095531135 12:43188118-43188140 CAAATGAAGGAGAAACAGAAAGG - Intergenic
1095568848 12:43658839-43658861 AAGATGAAAGAAAAAGAGGAGGG + Intergenic
1095961644 12:47838649-47838671 CATATCATGGAGATAGAGAAAGG + Intergenic
1096335871 12:50755538-50755560 CAGATGGAGGAGAGAGAGAATGG + Intergenic
1096518142 12:52169649-52169671 CTGATCATGCAGAAACAGGAAGG + Exonic
1096665165 12:53159715-53159737 GAGAGGAATGAGAAAGAGGAAGG + Intronic
1096787432 12:54025474-54025496 AAGATCTAAGAGAAAGAAGAGGG + Intronic
1096864686 12:54555449-54555471 CAGAGGAAGGCGAAAGAGGTTGG + Intronic
1097070211 12:56349122-56349144 CAGGTCAAGGCGCGAGAGGAGGG - Intronic
1097223978 12:57466121-57466143 CACCTCAAGGAGGAAGAGGCAGG - Intronic
1097358249 12:58626941-58626963 CAGATCAAGGGGAAAAATGAGGG + Intronic
1097677625 12:62620038-62620060 CATATCAAGGAAAAAGAAAATGG - Intergenic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1097956610 12:65493348-65493370 CAAATTAAGGAGAAACAGGATGG - Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098222600 12:68285836-68285858 CAGATTTGGGAGAAAGAGGTGGG + Intronic
1098460794 12:70731024-70731046 GAGAGGAAGGAGAGAGAGGAAGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098883200 12:75937416-75937438 GATAGCAAGGAGACAGAGGAAGG + Intergenic
1099081350 12:78186462-78186484 CAGCTCAAGCAGAAAGTTGATGG - Intronic
1099158513 12:79209784-79209806 CAGATCAAGGAAAACTTGGATGG + Intronic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100371862 12:93975973-93975995 CAGATCCAGGAGACAGGGGAAGG - Intergenic
1101845292 12:108358654-108358676 TAGCTCAAGAAGAAAGAGAAGGG + Intergenic
1102874984 12:116442332-116442354 AAGATAAAGGAGGAAGATGAAGG + Intergenic
1103044826 12:117727395-117727417 CAGAAAAAGAAGAAAGAAGAAGG + Intronic
1103130552 12:118464786-118464808 TAGAACAAGGAGACACAGGAAGG + Intergenic
1103162840 12:118744492-118744514 GAGAGAAAAGAGAAAGAGGAAGG + Intergenic
1103212728 12:119178685-119178707 CAGCTCCTGGAGCAAGAGGAGGG + Exonic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103680663 12:122690966-122690988 AATAACAAGCAGAAAGAGGAAGG - Intergenic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1104075040 12:125381364-125381386 GAGACCAAGGAGGAAGATGAAGG + Intronic
1104669456 12:130670433-130670455 CAGAGCTAGGAGAGAGAGCAGGG - Intronic
1105299841 13:19123302-19123324 CAGAGAGAAGAGAAAGAGGAAGG - Intergenic
1105352915 13:19632106-19632128 CAGTTAAAGGAAAAAGAGGGAGG - Intergenic
1106122097 13:26868836-26868858 TAGGTCAAGAAGGAAGAGGATGG - Intergenic
1106836494 13:33640766-33640788 CAGATCAAGGAGTGAAGGGAGGG + Intergenic
1107314310 13:39114626-39114648 GAGATCATGGAGAAATAGGAAGG - Intergenic
1107649125 13:42526524-42526546 CAGATCAAAGAGAAAGAGGCAGG + Intergenic
1107933229 13:45323724-45323746 CAGAACAAAAAGACAGAGGAAGG - Intergenic
1108557639 13:51610853-51610875 CAGATGAATGCCAAAGAGGAAGG - Intronic
1109157717 13:58931358-58931380 CAGAACAAGCAGAAAAAGAATGG + Intergenic
1109158408 13:58940724-58940746 CAAATCAAGGAGGAAGAAAATGG - Intergenic
1109218794 13:59619472-59619494 CACATAAAGGAGAAAGAGAAAGG + Intergenic
1109351473 13:61188006-61188028 CAGAAGAAGGAGGCAGAGGAAGG + Intergenic
1109417090 13:62054289-62054311 TGCATCAAGGATAAAGAGGAGGG + Intergenic
1109497705 13:63196019-63196041 CAGTTCAAGGAGAAAGTGTTTGG + Intergenic
1109842645 13:67940101-67940123 CAGAAAAAGGAGAAAGACCATGG + Intergenic
1111375932 13:87379311-87379333 CTGATCAAGGGGGAAGAAGAGGG + Intergenic
1111608454 13:90571838-90571860 CAGATAAGTGAGAAATAGGATGG + Intergenic
1111657522 13:91172575-91172597 CAGATCAAGAAAAAAGATTAGGG + Intergenic
1111873494 13:93864244-93864266 CAGATCGGGAAGAAAGAGAAAGG - Intronic
1112247836 13:97750552-97750574 CAGAGAGGGGAGAAAGAGGAGGG - Intergenic
1112555351 13:100463066-100463088 CTGATGATGGAGAAAGAGGACGG + Intronic
1114241277 14:20870731-20870753 CAGCTCAAGGAAAGAAAGGAAGG + Intergenic
1114392226 14:22322368-22322390 AAGAAGAAGGAGAAAGAGAAAGG + Intergenic
1114436076 14:22708894-22708916 CATATCCAGGAGAGAGAGGATGG - Intergenic
1115410895 14:33073429-33073451 CAGGGCAAGGAGATAGAGGGTGG + Intronic
1115684651 14:35783288-35783310 CAACTCAAGGAGGAAAAGGAGGG + Intronic
1116378884 14:44239772-44239794 AAGATGGAGGAGAAAGAGCAAGG - Intergenic
1116620311 14:47193512-47193534 GAGATCAAAGATAAACAGGATGG - Intronic
1116628404 14:47297387-47297409 GAGAGAAAGAAGAAAGAGGAAGG + Intronic
1116955329 14:50917309-50917331 CAGATAAAAGATAAAGAGGTTGG + Intronic
1117197867 14:53359526-53359548 CAGATGAAGAACAGAGAGGAGGG + Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1118538896 14:66801632-66801654 TAGCTCAAGGAGAGAGAGGGGGG - Intronic
1118837624 14:69487814-69487836 CAGTGCCAGGACAAAGAGGAAGG + Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119346025 14:73925269-73925291 AAAATGGAGGAGAAAGAGGAAGG - Intronic
1119643583 14:76331750-76331772 CAAACCAAGCAGAAAGAGGCAGG - Intronic
1119770707 14:77219203-77219225 CTCAGCAATGAGAAAGAGGAAGG - Intronic
1119843530 14:77811085-77811107 GAGAGCAAGGAGAAAGGGTAGGG + Intronic
1119947437 14:78709648-78709670 CAGATCAGGTAGGAAGAGGCAGG + Exonic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121085011 14:91139251-91139273 GAGAACAAGGAGGAGGAGGAAGG - Intronic
1121620339 14:95343010-95343032 CAGATCAAAAAGAAAAAGAATGG + Intergenic
1121674846 14:95744099-95744121 CAGAACAAGAAGGTAGAGGAAGG + Intergenic
1122419551 14:101566852-101566874 TTGAGCAAGGAGAGAGAGGAGGG + Intergenic
1122569820 14:102688913-102688935 CAGATCAACTGGAATGAGGATGG - Intronic
1122680148 14:103454036-103454058 CAGGTTTAGTAGAAAGAGGATGG + Intronic
1123786079 15:23674963-23674985 CAGAACCAGGAGAGAGAGGAAGG - Intergenic
1124695318 15:31859607-31859629 CAGGTCCAGGAGAAACAGGGAGG - Intronic
1124987594 15:34636862-34636884 AAAATCAAGGAGAAAGGGGATGG + Intergenic
1125254819 15:37751411-37751433 AAGAGGAAGGAAAAAGAGGAAGG + Intergenic
1125320334 15:38480316-38480338 CAGATCAACGAGAAAAGGAAAGG - Intronic
1125409901 15:39395254-39395276 CAATGGAAGGAGAAAGAGGAAGG + Intergenic
1126549104 15:49907786-49907808 CAGATGTAGGAGAAAGAGTATGG - Intronic
1127585873 15:60377253-60377275 AATATCAAGGAGAAGGAGGAAGG + Intronic
1128310519 15:66629169-66629191 CAGACCCAGGGGAAGGAGGAGGG + Intronic
1129912870 15:79242582-79242604 CAGCTCAAGGAGTGAGGGGAGGG + Intergenic
1130424969 15:83787826-83787848 TTGAGAAAGGAGAAAGAGGAGGG - Intronic
1130744575 15:86637428-86637450 CAGATGAAGGTGAATGAGGCCGG + Intronic
1130795137 15:87199860-87199882 AAGAAAAAGAAGAAAGAGGAAGG + Intergenic
1130919958 15:88335564-88335586 CAGATGAAGGAGGGAGGGGAAGG + Intergenic
1131014151 15:89043506-89043528 AAGAGGAAGGAGGAAGAGGAGGG + Intergenic
1131018021 15:89073966-89073988 CAGTGCTAGGAGAAAGAGAAAGG + Intergenic
1131439286 15:92446872-92446894 GTGAGCAAGGAGAAAGGGGAAGG + Intronic
1131561762 15:93449807-93449829 CAGAACAAAGAGGCAGAGGATGG - Intergenic
1131579046 15:93622876-93622898 CTGATCAAAGAGAAAAATGAAGG - Intergenic
1131827307 15:96331753-96331775 CAGAACGTGGAGAAAGAGGGAGG - Exonic
1131861089 15:96653794-96653816 CAGATGAAGGAGGTAGTGGAGGG + Intergenic
1131949579 15:97666575-97666597 CAAATCAGGGGGAGAGAGGATGG - Intergenic
1132446298 15:101922868-101922890 CAGATCAATGAGTGAGAGGTTGG + Exonic
1132921679 16:2399187-2399209 CAGATCAATGAAACAGAAGAGGG - Intergenic
1133075479 16:3277285-3277307 CTGTCCAAGGAGAAAGAGGGGGG + Intronic
1133647556 16:7778317-7778339 TAGATAGAGGAGATAGAGGATGG + Intergenic
1134295235 16:12939686-12939708 CAGGTGATGGGGAAAGAGGAAGG - Intronic
1134377864 16:13695169-13695191 CAGACTAAGGAAAAAGAGGAGGG + Intergenic
1134757507 16:16681189-16681211 CAGATGAAGGAGTCAGGGGAAGG + Intergenic
1134988561 16:18677977-18677999 CAGATGAAGGAGTCAGGGGAAGG - Intergenic
1135565486 16:23508499-23508521 AAGATGGAGGAGAATGAGGAAGG - Intronic
1136032160 16:27511216-27511238 CAGAACAAGAAGCCAGAGGAAGG + Intronic
1136053612 16:27671656-27671678 CAGTTGCAGGTGAAAGAGGAAGG - Intronic
1136777547 16:32879812-32879834 GAGATCAATGACAAAGCGGAGGG + Intergenic
1136893077 16:33981702-33981724 GAGATCAATGACAAAGCGGAGGG - Intergenic
1137518412 16:49170851-49170873 CAGAGCAAGGAGAAAGTTGAAGG - Intergenic
1138141878 16:54575777-54575799 CAGCTCAAGGGGAAAAAGAAAGG + Intergenic
1138275168 16:55729047-55729069 CACCCCAAGGTGAAAGAGGAAGG + Intergenic
1139032483 16:62901832-62901854 CAAATATGGGAGAAAGAGGAAGG + Intergenic
1139167496 16:64584995-64585017 CATTTAAAGGAGAAAGAGAAAGG - Intergenic
1139178901 16:64722586-64722608 CAAATGAAGGAGATAGAGTAAGG + Intergenic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1139834689 16:69828803-69828825 GAGATCATGGAAGAAGAGGATGG - Intronic
1139946325 16:70644890-70644912 AAGAGGAAGGAGGAAGAGGAGGG + Intronic
1140049698 16:71469410-71469432 CACATCATGGGGAGAGAGGAGGG + Intronic
1140051289 16:71483785-71483807 CAGATGAAGTAGAGAGAGAAGGG + Intronic
1140178301 16:72687699-72687721 GAGAGAAAGGAGAAAGAGAATGG - Intergenic
1140345517 16:74209315-74209337 CAGACAAAGGAGAAAGAAAATGG + Intergenic
1140659411 16:77173455-77173477 TACATCAAGGAAGAAGAGGAAGG + Intergenic
1140774993 16:78241311-78241333 CAGACCAAGGAGGGAGAGAAAGG - Intronic
1140924893 16:79572707-79572729 CAGATCAAGAAGAAATTCGAAGG - Intergenic
1140973203 16:80033349-80033371 GAGAAAAAGGGGAAAGAGGAAGG + Intergenic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1203079961 16_KI270728v1_random:1141921-1141943 GAGATCAATGACAAAGCGGAGGG + Intergenic
1142799278 17:2335330-2335352 TGGATCAAGGAGGAACAGGATGG + Exonic
1142993475 17:3747230-3747252 CAAGTCAGAGAGAAAGAGGAGGG + Intronic
1143934975 17:10474203-10474225 CAGAACAATGAAAAAGTGGAGGG + Intergenic
1144212320 17:13025916-13025938 AAGAGAAAGGAAAAAGAGGAAGG - Intergenic
1144378433 17:14668705-14668727 GAGATTAAGGAGAAAGTGGGTGG - Intergenic
1144727626 17:17509818-17509840 CAGAGCCAGGAAGAAGAGGAAGG - Intronic
1144783341 17:17818662-17818684 CAGAGAAAGCAGGAAGAGGATGG - Intronic
1144876154 17:18398533-18398555 CAGATAAAGGAGAAACAAGGTGG - Intergenic
1145075315 17:19850062-19850084 CAGATCTAGGACAAAAAGCATGG + Intronic
1145156074 17:20545887-20545909 CAGATAAAGGAGAAACAAGGTGG + Intergenic
1145211642 17:21017627-21017649 TAGACCATGGAGGAAGAGGAAGG + Intronic
1145247858 17:21281399-21281421 TAGAGGAAGAAGAAAGAGGAAGG + Intergenic
1145262420 17:21362432-21362454 CAGATAAAGGAGAAGATGGATGG + Intergenic
1146450021 17:32965414-32965436 AAGATCAAGGGGCAGGAGGAAGG + Intergenic
1146805624 17:35863065-35863087 CAGCTGAAGGAGAAAAATGAGGG - Exonic
1146835936 17:36110699-36110721 CAAATCAAGGAGATATAGAAAGG - Intergenic
1147035748 17:37679123-37679145 CAGAGAAACGTGAAAGAGGAGGG - Intergenic
1147343729 17:39772581-39772603 GAGAACAAGAAGAAACAGGAAGG + Intronic
1147540077 17:41350046-41350068 CAGATGAGGGAGAAAGAAAATGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148833598 17:50453022-50453044 CAGATCTGGGAGAAAGGAGAGGG - Intronic
1149731342 17:58949664-58949686 CAGAGAAAGAAGAAAGAGAAAGG - Intronic
1149797932 17:59538565-59538587 AAGAATAAGGAGAAAGAAGAAGG - Intergenic
1150602564 17:66663469-66663491 CAGACCGAGGGGAAAGATGAGGG + Intronic
1150626233 17:66842867-66842889 CAGTTCTTGGAGAAAGAGCAGGG + Intronic
1153139104 18:1952220-1952242 CAGATAAAAGAGAGAGAGGGAGG - Intergenic
1153142941 18:1995543-1995565 CAAATAAAGGAAAAAGGGGATGG - Intergenic
1153577706 18:6539335-6539357 CAGAGCCAGGAGAGAGAGGAGGG + Intronic
1153807589 18:8722669-8722691 TAGATGGAGGAGGAAGAGGAGGG + Intronic
1153985974 18:10351144-10351166 CAAATGAAAGAGAAAGAGAATGG - Intergenic
1154297569 18:13163700-13163722 CAGATCCAGAAGAAGGAGAAAGG + Intergenic
1155096517 18:22560685-22560707 CAGCCAAAGGAGAAAGTGGAGGG - Intergenic
1155197274 18:23486763-23486785 CAAATCAGGGAGAAAGGGGGTGG + Intergenic
1155297921 18:24402240-24402262 CAGCTGAAGGAGCAAGAGCAGGG + Intergenic
1155450415 18:25957520-25957542 CAGGGCAAAGAGAAATAGGAAGG - Intergenic
1156139710 18:34091735-34091757 CTGATGCAGGAGAAAGAGGACGG + Intronic
1156614336 18:38765707-38765729 GAAAGGAAGGAGAAAGAGGAAGG - Intergenic
1156863445 18:41864431-41864453 CATAGCCAGGACAAAGAGGAAGG - Intergenic
1156953317 18:42931555-42931577 CAAGTCAAATAGAAAGAGGAAGG - Intronic
1156966506 18:43100575-43100597 TAGATACAGGAAAAAGAGGATGG + Intronic
1157319991 18:46626813-46626835 TAGATGAAGGAGACTGAGGAAGG - Intronic
1157366203 18:47066563-47066585 GAGATCAAGGAGCAAGAGCAAGG + Intronic
1157370863 18:47110035-47110057 GAGAGCAAGGAGAAAGGTGAAGG - Intronic
1157894806 18:51455682-51455704 AAGAGGAAGGATAAAGAGGAAGG + Intergenic
1158225086 18:55192472-55192494 AAGATCAAGTAGAAAGAGAAAGG + Intergenic
1158225088 18:55192513-55192535 AAGATCAAGTAGAAAGAGAAAGG + Intergenic
1158610127 18:58932175-58932197 AAGCACAAGGAGAAAGAGGGAGG - Intronic
1159134265 18:64318638-64318660 GAGAGGAAGGAGAAAGAGGGAGG - Intergenic
1160556072 18:79726241-79726263 CAAATGAAGGAGACAGAGGAAGG - Intronic
1160639012 19:110848-110870 CAGATCAATGAGTGAGAGGTTGG - Exonic
1161745987 19:6060517-6060539 AAGATAAAGGATAAAGAGCAGGG - Intronic
1161771740 19:6234434-6234456 CAGATAAAGGGGAACGAGGTGGG + Intronic
1161935375 19:7368625-7368647 CAGATGCAGGAGAAAGAGGGAGG + Intronic
1162316059 19:9938695-9938717 CAGGTCAATGAGAAAGAGCTTGG + Intergenic
1162662495 19:12181333-12181355 CAGATCAAGGAGAGTTAGGCCGG - Intronic
1163010488 19:14422467-14422489 AAAATAAAGAAGAAAGAGGAAGG + Intergenic
1163874235 19:19853150-19853172 CAGATGAAGGAGACATAGAAAGG + Intergenic
1164250190 19:23469049-23469071 GAGAAGAAGGAAAAAGAGGATGG - Intergenic
1164541942 19:29128024-29128046 AAGAGCAAGGGGAAAGCGGAGGG + Intergenic
1164584414 19:29457526-29457548 CAGGTCTAGGAGATAGAGGATGG - Intergenic
1164794293 19:31014015-31014037 GAGAAACAGGAGAAAGAGGAGGG + Intergenic
1165590171 19:36962195-36962217 CACATAAAGAAGAAAGAGAAAGG - Intronic
1166100648 19:40569685-40569707 CAGCTGCAGGAGAAAGAGGCAGG + Exonic
1166223004 19:41377470-41377492 CAGGTCTAGGGGACAGAGGATGG + Intronic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167553401 19:50176893-50176915 AAGATAAAGGAGAAATAGGCTGG - Intergenic
1167595885 19:50427931-50427953 CAGATCCAGGAGATGGAGGCCGG + Intronic
1167867007 19:52336738-52336760 CGGATCAAGGAGGAAAAGGGTGG - Intronic
1168298374 19:55388991-55389013 CAGCTCAAAGAGACAGGGGAGGG - Intronic
925485274 2:4321860-4321882 GAGAACAAGGAGAAAAAGGAAGG - Intergenic
925621810 2:5801238-5801260 CAGAACAAGGAAAAAGGTGATGG + Intergenic
925703712 2:6664221-6664243 GAGATGAAGGAGAAGGAGGAAGG + Intergenic
925826145 2:7850177-7850199 CAGGTAGAGGAGAAAGACGAGGG - Intergenic
926122669 2:10253435-10253457 CAGAGCAAGGAGCGAGAGGCAGG - Intergenic
926679021 2:15650012-15650034 CAGATCCAGAAGAAAAACGAGGG + Intergenic
927248351 2:20976363-20976385 AAGATCAAATAGAAAGATGAAGG - Intergenic
928221773 2:29409312-29409334 CAGTAGAAGGAGAAAAAGGAAGG - Intronic
929013362 2:37470160-37470182 AAGACCAACGAGAAATAGGAAGG - Intergenic
929385702 2:41403699-41403721 GAGAGGAAGGGGAAAGAGGATGG + Intergenic
929651512 2:43684356-43684378 CAGTTAAAGGAGAGAAAGGAAGG - Intronic
930035735 2:47083996-47084018 GAGATCAGCGAGAAGGAGGAGGG + Intronic
930725929 2:54681416-54681438 TAGATGAAGGAGGCAGAGGATGG - Intergenic
931533917 2:63250646-63250668 TAGAACAATGAGAAAGATGAGGG + Intronic
931668366 2:64625903-64625925 GAGAGGAAGGAGAGAGAGGATGG + Intergenic
931852956 2:66271665-66271687 GAGAGAAAGGAGAAACAGGAGGG + Intergenic
932752031 2:74377371-74377393 GAGGGGAAGGAGAAAGAGGAGGG - Intronic
933078522 2:77959304-77959326 CAGATCAATAAGAAAGAGTATGG - Intergenic
933849239 2:86352429-86352451 CAGCTCCAGGAGACAGAGGGAGG - Intergenic
933895373 2:86806437-86806459 CAGGCCAAGGACAAGGAGGAAGG - Intronic
934568209 2:95352333-95352355 CAGGTCAGGGAGAAAGAGCAGGG + Intronic
934586167 2:95498051-95498073 GAGAAGGAGGAGAAAGAGGAGGG - Intergenic
934874912 2:97908571-97908593 ATGAGCAAGGGGAAAGAGGAGGG + Intronic
935164465 2:100558096-100558118 CAGAAGAAAGAGAGAGAGGACGG + Intergenic
935354728 2:102187668-102187690 CAGACGAAGGAGACAGGGGAAGG + Intronic
935658348 2:105443943-105443965 CAGCTCAGGGAGGGAGAGGAGGG - Intergenic
935733712 2:106089022-106089044 CATAGAAAGAAGAAAGAGGATGG - Intergenic
936249740 2:110859185-110859207 CAAAACAAAGAGAAAGAGAATGG + Intronic
936852084 2:116912494-116912516 CAGATGGAAGAGAAAGTGGAAGG + Intergenic
937528390 2:122798986-122799008 GAGGGGAAGGAGAAAGAGGAGGG - Intergenic
937568234 2:123323369-123323391 CAGTTAAAGGAGAAAGTGCATGG + Intergenic
937645104 2:124257821-124257843 CAGACCAAGTAGAGAGATGAAGG - Intronic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938241474 2:129745345-129745367 CAGGTGAGGGAGAAAGAGAATGG + Intergenic
938287984 2:130134574-130134596 CAGAGAGAAGAGAAAGAGGAAGG - Intergenic
938396176 2:130950102-130950124 CAGCTGAAGGAGGATGAGGAAGG + Intronic
938427604 2:131204303-131204325 CAGAGAGAAGAGAAAGAGGAAGG + Intronic
938468541 2:131538325-131538347 CAGAGAGAAGAGAAAGAGGAAGG + Intergenic
938620321 2:133045456-133045478 CAGATCAAAGAGAAACATGAAGG + Intronic
939056765 2:137374406-137374428 CACATTAAGGACAAAGAGAATGG - Intronic
939059825 2:137408315-137408337 AAGATAAAGGAGAAGGGGGAAGG - Intronic
939524227 2:143272283-143272305 CAGAAAAAGCAGAAAGAGTATGG - Intronic
939637460 2:144599839-144599861 CATATCAAGGTGAGAGATGATGG - Intergenic
939909730 2:147965143-147965165 TACATAAAGGAGAAAGAGAAAGG + Intronic
940073880 2:149719308-149719330 CAGATCAAGGCTAAAGACCATGG + Intergenic
940164056 2:150748397-150748419 AAGAAAAAGAAGAAAGAGGAAGG - Intergenic
940276892 2:151948996-151949018 GAGAGCAAGCAGAAAGAGGTAGG - Intronic
940332468 2:152490178-152490200 CAAAAAAAGGGGAAAGAGGAGGG + Intronic
940344658 2:152616779-152616801 GAAAGTAAGGAGAAAGAGGAGGG - Intronic
940837990 2:158546706-158546728 CAGGTTAAGGATAAAGAGCAAGG + Intronic
941231967 2:162921466-162921488 AAGAAAGAGGAGAAAGAGGAAGG + Intergenic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
941446492 2:165607174-165607196 CCTATGAAGGAAAAAGAGGAGGG - Intronic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
942117575 2:172743219-172743241 CTGAGGAAAGAGAAAGAGGATGG + Intronic
943280330 2:185924073-185924095 CAGAACAGGGAGAGAGAGTATGG - Intergenic
943498344 2:188653059-188653081 CAAAACAAGGAGAAAAATGATGG + Intergenic
943939166 2:193968836-193968858 AAGATAAAGGAGAAAAAGCATGG - Intergenic
943953865 2:194161848-194161870 AAGATCAAGGGGAAGCAGGAGGG - Intergenic
943985627 2:194614496-194614518 CAGATGAAGTAGAAATAGCAAGG - Intergenic
944517716 2:200528949-200528971 CAGATCAAGTAAAAAGAGACTGG + Intronic
944686325 2:202121087-202121109 AAGTCCAAGGAGAACGAGGAGGG - Intronic
944817598 2:203394099-203394121 GAGATCAAGGTGAAAGTTGAGGG + Intronic
945155438 2:206832850-206832872 TAAATGAAGGAGAAGGAGGAAGG - Intergenic
945159384 2:206873692-206873714 CTGTTTAAAGAGAAAGAGGATGG + Intergenic
945632352 2:212296340-212296362 CTAATCAAGGAGAAAGTAGAGGG + Intronic
945754693 2:213831678-213831700 CAGTTCAAGGAGATAAGGGAAGG - Intronic
945924973 2:215794123-215794145 CAAAGCAAGGAGGAAAAGGAGGG + Intergenic
946071492 2:217037955-217037977 AAGATAAAGGAGAAAGTGGGTGG - Intergenic
946308545 2:218870254-218870276 CAGATCCTGGAGCAAGAGAAGGG + Intronic
946469203 2:219940662-219940684 CTCACCTAGGAGAAAGAGGAAGG - Intergenic
946748885 2:222872757-222872779 CTGATCTAGGAGAAGGGGGATGG + Intronic
947137329 2:226988218-226988240 AAGATCAAGAAGCAAGAGGTTGG + Intronic
947298166 2:228656277-228656299 CAATTCAAGGAGAGAAAGGAAGG + Intergenic
947576956 2:231283151-231283173 CAGAGCAGGGAGAAAAAAGACGG + Intronic
948278299 2:236727081-236727103 CACATGCAGGAGAAAGAGGATGG + Intergenic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
948881644 2:240860798-240860820 CAGAACAAGGACAAGGATGAGGG + Intergenic
1168854770 20:1001004-1001026 CTGAGCAAGGATAAAGGGGAAGG - Intronic
1169792364 20:9425025-9425047 AAGACAAAGGAGAAGGAGGAAGG - Intronic
1170173749 20:13444048-13444070 CAGATGAAGGAAAAAAAGCACGG - Intronic
1170787143 20:19477363-19477385 CAAATCCAGGAGAAAGAGGCAGG + Intronic
1171283896 20:23922368-23922390 GAGACAAAGGAAAAAGAGGAGGG - Intergenic
1172208182 20:33179574-33179596 CGGAGAAAGGAGGAAGAGGAGGG - Intronic
1173035851 20:39409234-39409256 GAGGTCACTGAGAAAGAGGATGG - Intergenic
1173048760 20:39538503-39538525 CAGGTGCAAGAGAAAGAGGAAGG - Intergenic
1173107593 20:40152338-40152360 CAGATGAAGCAGAAATATGAGGG + Intergenic
1173406775 20:42773189-42773211 CAAATCAAGGAAAAATAGCATGG - Intronic
1173800257 20:45890765-45890787 GAGATCGAGGAGAAAGAGCTGGG - Exonic
1174704139 20:52638606-52638628 AACATAAAGGAGGAAGAGGAAGG + Intergenic
1174845970 20:53943444-53943466 AAGATAATGGAGAAAGAGTATGG + Intronic
1175452086 20:59077904-59077926 GAGGGCAAGGAGAAAGAGAAAGG + Intergenic
1175802247 20:61807475-61807497 GAGATGGAGTAGAAAGAGGAGGG - Intronic
1176523180 21:7840729-7840751 CACACCAATGAGAAATAGGAGGG + Intergenic
1177200880 21:17954519-17954541 TAGAACAAAGAGACAGAGGAAGG + Intronic
1178457855 21:32772203-32772225 CAGATGAGGGAGGAGGAGGAGGG + Intergenic
1178657200 21:34470741-34470763 CACACCAATGAGAAATAGGAGGG + Intergenic
1180867035 22:19125617-19125639 TCGACCAGGGAGAAAGAGGAAGG + Intergenic
1182395884 22:30035685-30035707 CAGAAGCAGGAGGAAGAGGAAGG - Intergenic
1182789698 22:32940859-32940881 TAGGTTAAGGAGACAGAGGATGG - Intronic
1182975306 22:34618542-34618564 TAGATAAAGTAGAAAGATGATGG - Intergenic
1183532818 22:38372598-38372620 TACATAAAGGAGAAAGAGAAAGG - Intronic
1184008690 22:41730409-41730431 CAGATGAAGTAGCAAGAGTAAGG + Intronic
1184268834 22:43365937-43365959 CAGACCATGGAGAGAGAGGCTGG + Intergenic
1184275628 22:43408031-43408053 CAGCTCGAGGAGAAAGGGGATGG - Intergenic
1184409702 22:44319419-44319441 GGGATGAAGGGGAAAGAGGAGGG + Intergenic
1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG + Intergenic
1185277042 22:49954291-49954313 CTGCTCACGGAGAAAGAGCAAGG - Intergenic
949159698 3:865940-865962 CACATGAAGGAGAAATATGAAGG - Intergenic
949760183 3:7462060-7462082 CAAATAAAGAAGAAAAAGGAAGG - Intronic
950664948 3:14489762-14489784 CAGCCCAAGGCTAAAGAGGAGGG - Exonic
950850176 3:16054747-16054769 CAGATAAAGGAGAAAGAAAATGG - Intergenic
951068602 3:18297508-18297530 CACATAAATGAGAAAGAGAAAGG + Intronic
951641805 3:24844816-24844838 GGGAGCAGGGAGAAAGAGGAGGG - Intergenic
951762285 3:26160336-26160358 GACTTCCAGGAGAAAGAGGAGGG + Intergenic
951881178 3:27483380-27483402 CAGGCCAAGTAGAAGGAGGAGGG - Intronic
952586667 3:34901094-34901116 GATTTCAAGGATAAAGAGGAAGG - Intergenic
952985870 3:38782458-38782480 AAGAACAAAGAGAAAGAGAATGG - Intronic
953145539 3:40271164-40271186 GAGACCAAGCAGAAAGAGGAAGG + Intergenic
953251676 3:41249750-41249772 CTGACCAAGGGGAAAGAGGCAGG + Intronic
953737445 3:45508497-45508519 CAGAACAAGGAAGAAGAGGAAGG + Intronic
955063053 3:55510681-55510703 CAGATTAAAGAAATAGAGGAGGG + Exonic
955421270 3:58740373-58740395 CTGCTCAAGGAGCAAGAGGATGG - Intronic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
957323693 3:78664787-78664809 CACAGCAAGGAGAAAAATGAGGG - Intronic
957573289 3:81976712-81976734 AAGAAGGAGGAGAAAGAGGAGGG + Intergenic
957906202 3:86559413-86559435 AAAATCAAATAGAAAGAGGATGG - Intergenic
958041550 3:88231888-88231910 CAGATTAAAGGGGAAGAGGAAGG - Intergenic
958190348 3:90176324-90176346 CAGTTCAATGAACAAGAGGAGGG - Intergenic
958412024 3:93829916-93829938 CAGTTCAATGAACAAGAGGAGGG - Intergenic
958690390 3:97458730-97458752 AACATGAAGGAGAAAGAGAAGGG + Intronic
958827075 3:99042946-99042968 CATACAAAGGAGAAAGAGAAAGG + Intergenic
959002529 3:100981404-100981426 GAGAGAAGGGAGAAAGAGGAGGG + Intronic
960121677 3:113953672-113953694 CAGAAAAAGCACAAAGAGGAGGG - Intronic
960799665 3:121525447-121525469 CTGATGAAGGAGAAACAGAAGGG + Intronic
960876695 3:122303063-122303085 CAGTTCAAGTAGAGAAAGGAAGG - Intergenic
960953189 3:123012759-123012781 AGGATGAAGGAGGAAGAGGAGGG - Intronic
961006663 3:123410152-123410174 CAGAACTAGGAGAATGAGAAAGG + Intronic
961049775 3:123736580-123736602 CGACTCAAGGAGAAAGAGGCAGG + Intronic
961207059 3:125092668-125092690 CTGATGAAGGAGAAAGATGGAGG + Intronic
962370551 3:134817661-134817683 GAGCTCAAAGAGAAAGAGGTTGG - Intronic
962564989 3:136648759-136648781 AAGATTAGAGAGAAAGAGGAAGG - Intronic
962607558 3:137045125-137045147 GAGATGTAGGATAAAGAGGAAGG + Intergenic
962613992 3:137105777-137105799 TAGAGCCTGGAGAAAGAGGAAGG - Intergenic
962938075 3:140100000-140100022 AAAACGAAGGAGAAAGAGGATGG - Intronic
963543130 3:146620280-146620302 CAGATAAAAGAAAGAGAGGAAGG - Intergenic
963570491 3:146988827-146988849 CAAATCAAGTAGACAGAAGATGG + Intergenic
964278209 3:155031448-155031470 CAGATCATAGAGGAAGAAGAAGG + Intronic
964281298 3:155069258-155069280 CAAATGGAGGACAAAGAGGAGGG + Intronic
965906494 3:173713980-173714002 AAGAAAAAGGAGAAAGATGAAGG + Intronic
966062693 3:175778765-175778787 TAGATCATGGAGAGAGAGAATGG + Intronic
966351452 3:179036495-179036517 TAGATAAAGGAGAAAGACGCAGG + Intronic
966958564 3:184910093-184910115 CAAAGAAAAGAGAAAGAGGAAGG - Intronic
967630984 3:191742784-191742806 AAGATAAAGGAGCAACAGGAGGG - Intergenic
967644399 3:191903772-191903794 CAAGTGAAGAAGAAAGAGGAAGG - Intergenic
968048725 3:195638902-195638924 CAGCTCCAGGAGAAACAGGGTGG - Intergenic
968091359 3:195900237-195900259 CAGCTCACCGAGAGAGAGGAGGG + Intronic
968098680 3:195950722-195950744 CAGCTCCAGGAGAAACAGGGTGG + Intergenic
968268680 3:197382671-197382693 CACATCAAGGAGAAGATGGAAGG - Intergenic
968305893 3:197651022-197651044 CAGCTCCAGGAGAAACAGGGTGG + Intergenic
969261352 4:6036118-6036140 CAGATCACACAGACAGAGGAAGG + Intronic
970162080 4:13199026-13199048 GAGAACAAGGATGAAGAGGAAGG + Intergenic
970211857 4:13718132-13718154 AAGATCAAGGAGAGAGATTAAGG - Intergenic
970564474 4:17318353-17318375 GAAATGAAGGAGAAAGAGAATGG - Intergenic
970758339 4:19452724-19452746 GAGATGGAGGAGGAAGAGGAGGG + Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971189708 4:24415629-24415651 CAGAACACTGAGAAAGAAGAGGG + Intergenic
972362841 4:38344938-38344960 CAGAACAGGGTGAAAGGGGAAGG - Intergenic
972485484 4:39536193-39536215 CAGCTAGAGGAGAATGAGGAGGG - Intergenic
973012847 4:45098023-45098045 CAGATGAGGTAGAAAGAGAAAGG + Intergenic
973020928 4:45205772-45205794 CAGTTCCAGGAGAAAGAGACAGG - Intergenic
973178620 4:47240869-47240891 AAGGTGAAGGAGAAAGAGAATGG - Intronic
973246049 4:48012510-48012532 CAGCAAAAGGAAAAAGAGGAAGG - Intronic
973769733 4:54195426-54195448 CAGATGAAGGAGGGAGGGGAGGG + Intronic
973885611 4:55318020-55318042 GAGGGCAAGGAGGAAGAGGAAGG + Intergenic
974137966 4:57843515-57843537 CAGATCATGGATGAAGAGAATGG - Intergenic
974703086 4:65476578-65476600 CAGAGCACGGAGTGAGAGGAGGG + Intronic
975483338 4:74906433-74906455 CAGAAGAAGGAGGAAGAGAAAGG + Intergenic
975859909 4:78665760-78665782 CAGATGAAGCAGAAAGAAAAAGG - Intergenic
976095822 4:81507141-81507163 AAGATAAAGGACAAAGTGGAGGG - Intronic
976891254 4:90050448-90050470 CAGATGAAGGAGTCAGAGAAGGG + Intergenic
977374213 4:96180571-96180593 CAGGGGAAGGAGAGAGAGGAGGG - Intergenic
977726296 4:100300670-100300692 CAAATCAAGGAGATTGGGGAAGG - Intergenic
977856441 4:101900615-101900637 CAGATGAAGGAAAGAGAGGACGG + Intronic
978858339 4:113418789-113418811 TAGAGCAAGGAAAAATAGGAAGG + Intergenic
979207611 4:118059078-118059100 GAAATCAAAGAGAGAGAGGAAGG - Intronic
979405014 4:120299168-120299190 AAGAAAAAGGAGAAAGAGGAAGG - Intergenic
979441704 4:120757924-120757946 CAGATCAAGGAGAGAGATGGAGG - Intronic
980176867 4:129356460-129356482 CATCAGAAGGAGAAAGAGGAGGG - Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980938934 4:139254178-139254200 CTGAGCAAGGAGACAGAAGATGG + Intergenic
981165091 4:141548367-141548389 TAGAACAAGGAAAAAGATGAAGG + Intergenic
982014787 4:151142637-151142659 CAGATCATGGGAAAAGTGGAAGG - Intronic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
982663961 4:158238318-158238340 CAGATAAAGGAGAATTTGGAGGG + Intronic
982719942 4:158849020-158849042 GAGATCAAGAAGAATCAGGATGG - Intronic
982869255 4:160555500-160555522 AAAATCAATTAGAAAGAGGATGG + Intergenic
983523413 4:168734937-168734959 GAGAGAGAGGAGAAAGAGGAGGG + Intronic
983659288 4:170116889-170116911 CAGAACAAAGAGTAGGAGGACGG - Intergenic
984189552 4:176589019-176589041 TAGTAGAAGGAGAAAGAGGAAGG + Intergenic
984251375 4:177339555-177339577 TAGATTGAGGAGGAAGAGGAGGG + Intronic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
985384921 4:189435100-189435122 CCAATCATGGTGAAAGAGGAAGG + Intergenic
985742922 5:1630237-1630259 CAGCTCCAGGAGAAACAGGGTGG + Intergenic
985853691 5:2408602-2408624 CAAATCAGGGAGCAAGAGGGGGG - Intergenic
985956216 5:3268139-3268161 CAGATCATGAAGGCAGAGGAAGG - Intergenic
986138647 5:5007913-5007935 AAAATCAAGGAGATAGAGAATGG - Intergenic
986597373 5:9437751-9437773 CTTACCAAGGAGAGAGAGGATGG + Exonic
986618297 5:9643028-9643050 GAGAGGAAGGATAAAGAGGAAGG - Intronic
987214638 5:15721535-15721557 CAGAGAGAGGAGAAAGGGGAAGG - Intronic
987800644 5:22692195-22692217 CAGTTCATGGTGGAAGAGGAAGG - Intronic
987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG + Intergenic
987849632 5:23333736-23333758 AAAACAAAGGAGAAAGAGGAAGG - Intergenic
988053949 5:26068077-26068099 GAGATGAAGGAAAAAGAGAAGGG + Intergenic
988243461 5:28645072-28645094 CAGAAGAAGAAGAAAGAGAAAGG + Intergenic
988276655 5:29089664-29089686 AAGAGGAAGTAGAAAGAGGAGGG - Intergenic
989619573 5:43371062-43371084 CAGATTAAGAAAAAAGAAGAAGG - Intergenic
989823204 5:45820534-45820556 CTGATCCATGAGAAAGATGAAGG + Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990264300 5:54059108-54059130 CAGATTAAGGAAAAATAGGAGGG - Intronic
991345415 5:65660848-65660870 CAAATCTAGGTGAAAGGGGAAGG + Exonic
991530017 5:67604668-67604690 CACATGAAGGGGCAAGAGGAAGG - Intergenic
991942924 5:71871670-71871692 CAGATGAAGAAGAAAGTGGTTGG + Intergenic
992018861 5:72602771-72602793 CAGAGCTAGGAAGAAGAGGAAGG - Intergenic
992097393 5:73375665-73375687 AAGAACAAGCAGGAAGAGGAAGG + Intergenic
992149535 5:73889316-73889338 CAGTTAAAGTAGCAAGAGGATGG + Intronic
992384423 5:76270044-76270066 GAGACAAAGGAGAAAGGGGATGG + Intronic
992595225 5:78339925-78339947 CAGACTCAGGAAAAAGAGGAAGG - Intergenic
992673879 5:79085912-79085934 CAAAGTAAGAAGAAAGAGGATGG + Intronic
992830699 5:80590698-80590720 CAGGGCAAGGAGAAAGGTGATGG + Intergenic
993280797 5:85921709-85921731 CAGAGCACTGAGAAAGAGCAAGG + Intergenic
993361508 5:86982168-86982190 CAGCAAAAGGGGAAAGAGGAAGG - Intergenic
993554961 5:89325253-89325275 CTGATAAAGGAGGAAGTGGAAGG - Intergenic
993634687 5:90329749-90329771 CACACAAAGGAGAAAGAGAAAGG - Intergenic
993904277 5:93605424-93605446 CAGATCAAGTGCAAAAAGGAGGG - Intergenic
994209292 5:97070286-97070308 TTGATCCTGGAGAAAGAGGAAGG - Intergenic
994666104 5:102707521-102707543 GAGATCAATGAAAAAGAGAAAGG + Intergenic
994804234 5:104422531-104422553 TAGGCTAAGGAGAAAGAGGAGGG + Intergenic
995288872 5:110426117-110426139 TAGAAGAAGGAGAAAGAGAAAGG - Intronic
995615666 5:113960476-113960498 AAGGTCAAGGAGAGAGATGAGGG + Intergenic
996501395 5:124220560-124220582 AAGAAAAAGAAGAAAGAGGAGGG - Intergenic
996651333 5:125880455-125880477 CAGAGCAAGGAGAAAAAAAATGG + Intergenic
997378589 5:133418210-133418232 CTGATCAAGAAGAAAAAAGATGG + Intronic
997584769 5:135037801-135037823 TAGATCAGGCAGAAAGAGGTAGG - Intronic
997681096 5:135751232-135751254 CAGGCCCAGGAGAAGGAGGAGGG - Intergenic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
999693190 5:154166473-154166495 GAGATAAAGGAAAAAGAAGATGG + Intronic
1001092051 5:168748755-168748777 GAAAGAAAGGAGAAAGAGGAAGG - Intronic
1002000964 5:176196034-176196056 AGGATGCAGGAGAAAGAGGAGGG - Intergenic
1002167249 5:177355853-177355875 CAGCTGAAGGAGAAAGAGGGAGG + Intergenic
1002253370 5:177942938-177942960 AGGATGCAGGAGAAAGAGGAGGG + Intergenic
1002663251 5:180804830-180804852 CAGGTGAAGGGGAAACAGGATGG + Intronic
1002715917 5:181227171-181227193 CAGATCAAGAAAAGAGAGTATGG - Intronic
1002795100 6:465644-465666 AGGAGAAAGGAGAAAGAGGATGG - Intergenic
1002969140 6:1996162-1996184 TAGAAGAATGAGAAAGAGGAAGG - Intronic
1003262392 6:4531279-4531301 AAGAGCAAGGAAAAAGAGAAAGG + Intergenic
1003389821 6:5703964-5703986 CAGAGGAAGGAGGAAGAGGGAGG - Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1004208076 6:13611028-13611050 TAGAAAAAAGAGAAAGAGGAAGG - Intronic
1004345294 6:14843703-14843725 CAGACCAAGGGAAAAGAAGAGGG - Intergenic
1004368474 6:15031865-15031887 GAGAAGAAGAAGAAAGAGGAGGG + Intergenic
1004704228 6:18108908-18108930 CAGATCAAGGAAAATAAAGAGGG + Intergenic
1004873878 6:19935782-19935804 CAAATAAAGGAGAAAGAGTGTGG - Intergenic
1005468677 6:26140675-26140697 CAGATTAAGGATGAAGAGGCTGG + Intergenic
1006474283 6:34244828-34244850 CAGGAGAAGGAGGAAGAGGAGGG + Exonic
1006590317 6:35150443-35150465 CTGATGAAGTACAAAGAGGAGGG - Intergenic
1006635712 6:35459889-35459911 CTCATAAAGGAGAAAGAGGATGG - Intronic
1006748096 6:36359143-36359165 CAGATTAAACAGAAAGGGGATGG + Intronic
1006961106 6:37931186-37931208 CAGCTCAAAGGGACAGAGGAAGG + Intronic
1007198968 6:40089023-40089045 CAGAACAAGATGAAGGAGGAGGG + Intergenic
1007208096 6:40169173-40169195 AAGTTTAAGGAGGAAGAGGATGG - Intergenic
1008683880 6:53903206-53903228 TTGATCAAGGAGCCAGAGGATGG + Intronic
1008857650 6:56111298-56111320 CAGATCAGTGGGAAATAGGAAGG + Intronic
1009029457 6:58038885-58038907 CAGATCCAGGAGAGAAATGAGGG - Intergenic
1009204994 6:60790275-60790297 CAGATCCAGGAGAGACATGAGGG - Intergenic
1009234456 6:61105664-61105686 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1009707708 6:67276045-67276067 GAGTTCAAGGAGGCAGAGGAAGG - Intergenic
1012272211 6:97227396-97227418 CAAAACAAGAAGGAAGAGGAGGG - Intronic
1012471597 6:99578624-99578646 CAGAACAAAAAGACAGAGGAAGG - Intergenic
1012494436 6:99818965-99818987 CAGCTCTAGGAGAAAGAGAGAGG - Intergenic
1012627963 6:101427306-101427328 CAGAGCAATGAGAATGGGGATGG - Intronic
1012811079 6:103959059-103959081 CACAGCAGAGAGAAAGAGGAAGG + Intergenic
1013184342 6:107744963-107744985 AAAGTCCAGGAGAAAGAGGAAGG - Exonic
1013351705 6:109311802-109311824 GTGATGAAGCAGAAAGAGGAAGG - Intergenic
1013354137 6:109332467-109332489 CAGCTCAAGGGGAGAGAGGCTGG - Intergenic
1013682261 6:112537620-112537642 CATATCATGGAGTCAGAGGAGGG + Intergenic
1014288701 6:119533599-119533621 CAGATGAAGGAGGGAGAGGGAGG + Intergenic
1014352255 6:120359877-120359899 TAGATCAAGCAGAAGAAGGATGG + Intergenic
1014490604 6:122057197-122057219 CAGATAAAGGGGAGAGAGGCAGG + Intergenic
1014645547 6:123968236-123968258 GAGAGCAAAGAGAAAGAGGTGGG + Intronic
1014769011 6:125440079-125440101 CTGAGCAAGGAAATAGAGGAAGG - Intergenic
1014820932 6:125987643-125987665 TAGGGCAAGGAGTAAGAGGATGG + Intronic
1014844647 6:126260189-126260211 CAAATAAACAAGAAAGAGGAAGG - Intergenic
1015334153 6:132017120-132017142 AAGTTCAATGAGAAAAAGGATGG - Intergenic
1015845208 6:137513237-137513259 CAGTTCAAGGAAAAAGAGGGGGG + Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1017245428 6:152219129-152219151 CAGCTCATGGAGAAAAAAGAGGG + Exonic
1017305017 6:152907429-152907451 CAGATCATAGAGAAAGCAGATGG + Intergenic
1017657440 6:156643488-156643510 CACATCAAGGAAGAAGAGGTGGG + Intergenic
1017753097 6:157507123-157507145 GGGATTAGGGAGAAAGAGGAAGG - Intronic
1018100783 6:160437822-160437844 GATATCAGGGAGAGAGAGGACGG + Intronic
1018694331 6:166379731-166379753 CTGATGAAGTAAAAAGAGGAAGG + Intronic
1018788266 6:167125680-167125702 CAGAACCAGAAGAAAGAGGGAGG - Intronic
1019351811 7:557552-557574 CAGAGGAGGGAGAAACAGGATGG + Intronic
1019398432 7:836205-836227 AAGATGTAGGAGAACGAGGAAGG + Intronic
1019805046 7:3117547-3117569 AAGAGAAAGGAGAGAGAGGAGGG + Intergenic
1020425203 7:8057717-8057739 CAGATTAAGAAGAAAAAGGAAGG - Intronic
1020431852 7:8123371-8123393 GAGATGAAGGCGGAAGAGGAGGG + Intronic
1021482919 7:21137354-21137376 CAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1021629164 7:22626871-22626893 CAGATCCAGGACAAAGGGAAGGG + Intronic
1021723206 7:23524911-23524933 CAGATCAAGGAGTCAGGAGATGG - Intronic
1021778505 7:24078255-24078277 CAGATCAAGAAGAAATAAAAAGG + Intergenic
1021824552 7:24535913-24535935 GAGATGAAGGAGGAAGAGGAAGG - Intergenic
1022141992 7:27500676-27500698 CAAACCAGGGAGAAGGAGGAGGG + Intergenic
1022659791 7:32356111-32356133 CAGCTCAATCAGAAAGTGGATGG + Intergenic
1022959708 7:35414832-35414854 CAGTTGAATGAGAAAGTGGATGG + Intergenic
1023047089 7:36219590-36219612 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023047096 7:36219639-36219661 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023066814 7:36386200-36386222 CAGGTCAATGAGAGAAAGGATGG + Intronic
1023214496 7:37847531-37847553 AAGAAGAAGGAGAAAGAAGAAGG + Intronic
1024156020 7:46626364-46626386 CAACCCAAGGAGAGAGAGGATGG + Intergenic
1024505125 7:50156334-50156356 CAGATCAAGCAGAAACAGTCAGG - Intronic
1024839701 7:53571652-53571674 CAGACCCAGGAGAAGGAAGAGGG - Intergenic
1025481073 7:60983555-60983577 AACTGCAAGGAGAAAGAGGATGG - Intergenic
1026158951 7:67852217-67852239 AAGAGAAAGGAGAAAGAGGAGGG + Intergenic
1026159082 7:67852903-67852925 AAGAACAAGGAGATAGAGGGGGG + Intergenic
1026627432 7:72008483-72008505 CAGAACAAGAAGCAAGAGAAGGG + Intronic
1026791696 7:73336920-73336942 GAGATCAAGGAAACAGAAGAAGG + Intronic
1027475505 7:78626015-78626037 TAAATCAAGGAGAAAGTAGAGGG + Intronic
1027526636 7:79277774-79277796 CATCTCAAGGAGACAGAGAAAGG - Intronic
1027604212 7:80280121-80280143 CAGATCAAGGAAAGGGAGGGTGG + Intergenic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1029549672 7:101231046-101231068 GAGATGAAGGAGAAAGGGGAGGG + Intergenic
1029956686 7:104647772-104647794 AGGAAGAAGGAGAAAGAGGAAGG + Intronic
1029966397 7:104745245-104745267 AGGAAGAAGGAGAAAGAGGAAGG - Intronic
1030099336 7:105931347-105931369 GAGAGGAAGGGGAAAGAGGAGGG - Intronic
1030131810 7:106207910-106207932 CAGAGCAAGGAGACAGGAGAAGG - Intergenic
1030766462 7:113416214-113416236 CAAATGAAGAAGAAAGAGCAGGG + Intergenic
1031067491 7:117120968-117120990 TAGATCAAGTAGAGAGAGAAGGG + Intronic
1031183777 7:118449687-118449709 CAAATCATGGAAAAAGAGAAAGG - Intergenic
1032554126 7:132813779-132813801 CAGGTGGTGGAGAAAGAGGAGGG + Intronic
1032855569 7:135830761-135830783 CAGAGAAAGGAGAAAGCAGAAGG + Intergenic
1032955813 7:136971012-136971034 CAGATAATGGACTAAGAGGATGG - Intronic
1033449148 7:141447537-141447559 CAGAGCAAGCAGAATGCGGATGG - Intronic
1033985815 7:147224106-147224128 CAGATTAAAGAGACAGATGAGGG - Intronic
1034218800 7:149428757-149428779 CAGAACAAGGGGAGAGACGATGG + Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034523552 7:151639579-151639601 CAGCTCCAGGAGAAAGAGCAAGG - Intronic
1034893689 7:154861461-154861483 CAGCTCGAGGAGGAAAAGGAAGG - Intronic
1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG + Intergenic
1035136249 7:156705785-156705807 CACACAAAGGAGAAAGAGAAGGG + Intronic
1036039647 8:5060994-5061016 CTGAGCAAGGAGGAAGAGGAAGG - Intergenic
1036116784 8:5967697-5967719 CACTTGAAGGAGAAAGAGGAGGG - Intergenic
1036588209 8:10144618-10144640 GAGATCAAGGAAAAAAAGCAGGG - Intronic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036908331 8:12728108-12728130 CAGATCAATGAATAAGAGAAGGG + Intronic
1037611541 8:20480390-20480412 CAGATCAAAGGGAAGGAGGATGG + Intergenic
1037658699 8:20908965-20908987 CCTATCATGGAGTAAGAGGAAGG - Intergenic
1037674596 8:21042827-21042849 CTCATCAGGGAGAAAGATGATGG - Intergenic
1037878397 8:22560749-22560771 CAAATCCAGGAGTCAGAGGAGGG + Intronic
1037915370 8:22769653-22769675 GTGATAAAGGAGAAAGAGGCTGG - Intronic
1038621632 8:29149021-29149043 CAGAGCAAGGTGATAAAGGAAGG + Intronic
1038662168 8:29506716-29506738 CAGAACAAAGATGAAGAGGAGGG - Intergenic
1038959639 8:32505015-32505037 CAGCTGAAGGAGGAAGAGAAAGG + Intronic
1039435943 8:37559341-37559363 GAGATGGAGGAGGAAGAGGAGGG + Intergenic
1040564804 8:48555894-48555916 CAAAAGAAAGAGAAAGAGGAGGG - Intergenic
1040894289 8:52349851-52349873 CAGAGCAAGGAGGGAGAGTAGGG + Intronic
1041029939 8:53726814-53726836 AAGATCATGGAGAAAGACCAGGG + Intronic
1041178431 8:55221873-55221895 CAGTTCATGAGGAAAGAGGAGGG + Intronic
1041296488 8:56362479-56362501 CAGTTCAAGGAGAGAGGGGATGG - Intergenic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042537255 8:69871170-69871192 AAGAGCAAGAAGAAAAAGGAAGG + Intergenic
1042982785 8:74549161-74549183 CAGATCAAGGTGAAAGGGGTGGG + Intergenic
1042991079 8:74640537-74640559 CAATTCAAAGAGAAAGAGGCAGG + Intronic
1043115602 8:76250045-76250067 GAGAAGAAGGAGGAAGAGGAAGG - Intergenic
1043358471 8:79441465-79441487 CAGATCGGAGAGAAAGAAGAGGG + Intergenic
1043854194 8:85245772-85245794 CTGAGCAGCGAGAAAGAGGAGGG - Exonic
1043917368 8:85938490-85938512 CTGTTAAAGAAGAAAGAGGAAGG - Intergenic
1044398073 8:91737105-91737127 CTGATAAAGGAGAAAGAAGTGGG + Intergenic
1044596802 8:93967587-93967609 AAGATCAAGGAGACAAAGAAGGG - Intergenic
1044821391 8:96158270-96158292 CCGATCCTGGAGATAGAGGAGGG - Intronic
1045071597 8:98511667-98511689 CATTTCCAGGAGAAAGTGGATGG - Intronic
1045076015 8:98569111-98569133 CTGAGCAAGGAAAAAGAGCAAGG + Intronic
1045085404 8:98677528-98677550 AAGACAAAGGAGGAAGAGGAAGG + Intronic
1045174916 8:99712318-99712340 AAGACCAGGGAGCAAGAGGAAGG + Intronic
1045351268 8:101342322-101342344 CAGATCAAAGAGATAATGGATGG + Intergenic
1045743110 8:105385814-105385836 CAGCTCAAGAATAGAGAGGAGGG - Intronic
1045889014 8:107132115-107132137 CAGCCAAAGGAGAAAGAGAAAGG - Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046123370 8:109873097-109873119 CAGATAAAGGAGATAGAAAAAGG - Intergenic
1046261234 8:111771140-111771162 TTGATCAAGGAGAATGAGGCAGG - Intergenic
1046652223 8:116848982-116849004 AAGATCAGGAAGAAAGAAGATGG - Exonic
1046749470 8:117911739-117911761 CAGTTCAAAGTGAAAGATGAGGG - Intronic
1046842489 8:118875285-118875307 GAGATGGAGGAGGAAGAGGAAGG - Intergenic
1046885740 8:119364970-119364992 CAGATCCAGGAGAAAGGGCATGG + Intergenic
1047601977 8:126434724-126434746 CAGTTAAAAGAGGAAGAGGAAGG + Intergenic
1048012227 8:130467035-130467057 CTGACCCAGGGGAAAGAGGAGGG + Intergenic
1048260847 8:132943873-132943895 CAGTTTAAGGAGCAAGAGAAGGG - Intronic
1048381985 8:133873535-133873557 TGGAGCAAGGAGACAGAGGAAGG - Intergenic
1048592436 8:135833297-135833319 CAGATAATGGAAAAAGAGAAGGG - Intergenic
1050222791 9:3413619-3413641 CAGAGCAAGGAGAAAGAAACAGG - Intronic
1050856350 9:10361850-10361872 GAGATTAAGGAGAAAGAGCATGG + Intronic
1051240985 9:15055486-15055508 CAGAAGAGGGAGAAAGAGAAAGG + Intergenic
1051749964 9:20330538-20330560 CAGTTCAAAGAGAAAGAGGAGGG + Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052333170 9:27292636-27292658 GAAATAAAGGAGAAAGAAGAAGG + Intronic
1052680110 9:31680321-31680343 CAGTTCAAAGAAAAAGAAGAGGG - Intergenic
1052860960 9:33437358-33437380 AAAATCAAGAGGAAAGAGGAAGG + Intergenic
1053274930 9:36776108-36776130 AAGATCAAGGAGAGACTGGAAGG - Intergenic
1053402750 9:37841145-37841167 CAGATCCAGGGGCAGGAGGAAGG + Intronic
1054754453 9:68943234-68943256 CAGATGAATGAGGAAGAGGGTGG - Intronic
1055053701 9:72004413-72004435 GGGCTCAAGGGGAAAGAGGAGGG + Intergenic
1056008458 9:82300355-82300377 CACAAAAAGGAGAAAGAGAAAGG - Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056553546 9:87671098-87671120 CAGATAACGGGGACAGAGGACGG - Intronic
1056786385 9:89595288-89595310 AAGTTCAATGAGGAAGAGGATGG - Intergenic
1056965185 9:91159452-91159474 GAGAGGAAAGAGAAAGAGGAGGG + Intergenic
1056983861 9:91342879-91342901 TAGGTTAAGGAGAAAGAGGAGGG - Intronic
1057986817 9:99725437-99725459 CTGATCAAGGAAAGATAGGAAGG - Intergenic
1057987056 9:99727783-99727805 CAGATCCAGGAGCAAAGGGAAGG - Intergenic
1058088210 9:100774031-100774053 GAGATGAAGGAGAAAGGGAAAGG - Intergenic
1058314868 9:103553593-103553615 TAGATGAAGGGGAAAGAAGATGG + Intergenic
1058388282 9:104464020-104464042 CAGATCAAAGAGATACAGGAAGG + Intergenic
1058942006 9:109822114-109822136 TAGCTCAAGGAAAAAGGGGAGGG + Intronic
1058972852 9:110098923-110098945 CAGAGCTGGGGGAAAGAGGAAGG - Intronic
1059447772 9:114349508-114349530 CACATCCAGGAGAGAGATGATGG - Intronic
1059789013 9:117619670-117619692 CAGATCAAACAGAAACAGGCAGG + Intergenic
1059935911 9:119310510-119310532 CAAATGCAGGAGAAAGAAGATGG + Intronic
1060668052 9:125444966-125444988 CAGATAAATGAGCAACAGGAAGG + Intronic
1060839410 9:126782020-126782042 CTGAGCAGGGAGAGAGAGGAGGG + Intergenic
1061541617 9:131280532-131280554 CTGAAAAATGAGAAAGAGGAGGG + Intergenic
1062484926 9:136769981-136770003 CAGGGCAAAGAGAGAGAGGAAGG - Intergenic
1062497923 9:136840361-136840383 AAGAGCAAGGACAAGGAGGAGGG + Exonic
1185603480 X:1354577-1354599 AAGAAAACGGAGAAAGAGGAGGG + Intronic
1185603490 X:1354616-1354638 GAGAAAATGGAGAAAGAGGAGGG + Intronic
1185661999 X:1735474-1735496 AAGAGGAGGGAGAAAGAGGAGGG - Intergenic
1185748317 X:2589785-2589807 CAGATCCAGGAGACAGAGCCAGG - Intergenic
1186392299 X:9173198-9173220 GAATTCAAGGAGAAAGTGGATGG - Intergenic
1186619526 X:11224180-11224202 AAGATGAAGAAGAAAGAAGAAGG + Intronic
1186619530 X:11224242-11224264 AAGATGAAGAAGAAAGAAGAAGG + Intronic
1187072872 X:15905660-15905682 CAGATAAAGGAGAAAAAGGCTGG - Intergenic
1187103103 X:16215116-16215138 CAGATCTAGGAGGAAGAAGGAGG + Intergenic
1187290735 X:17950951-17950973 AAAATCATGGTGAAAGAGGAAGG + Intergenic
1187944390 X:24412158-24412180 AAGCTCAAGGAGAAAGAGCAGGG - Intergenic
1188036461 X:25322941-25322963 GAGAAAAAGGAGAAAGAGGAAGG - Intergenic
1188107935 X:26165283-26165305 CAGGGCAAGGACAATGAGGAAGG + Intergenic
1188697084 X:33207107-33207129 CAGACAAATGAGAATGAGGAAGG - Intronic
1188933500 X:36144671-36144693 CAGAACAAAGAGACAGAAGAAGG + Exonic
1189081450 X:37977341-37977363 GACATCAAGGAGAAAGAAGGTGG + Intronic
1189512204 X:41674071-41674093 CAGAGGAGGAAGAAAGAGGAAGG + Intronic
1189645890 X:43131021-43131043 CAGAAGCAGGAGAAAGAAGAAGG + Intergenic
1190023615 X:46902396-46902418 GAGAGAAAGGAGAAAAAGGAAGG + Intergenic
1190095329 X:47475131-47475153 CTGATCAAGGTAAAAGAGAAAGG + Intronic
1190144154 X:47875147-47875169 CAGAGCAAGGAGGAGCAGGAGGG + Intronic
1190338131 X:49275322-49275344 AAGAGCCAGGAGAAAGAGAAGGG - Intronic
1190417053 X:50190528-50190550 CAGTTCAGGGAGAAATAGGAAGG + Intergenic
1190913423 X:54792110-54792132 CACATGAGGTAGAAAGAGGAGGG + Intronic
1191666977 X:63713535-63713557 CAGATAAAGGAGAGATTGGAGGG + Intronic
1191840368 X:65509461-65509483 CAGAACAAGGAGTAGAAGGAAGG - Intergenic
1192110845 X:68362619-68362641 GAGCTCAAAGGGAAAGAGGAAGG + Intronic
1193144156 X:78060026-78060048 CAGACCCAGGAGAGGGAGGAGGG + Intergenic
1193995743 X:88364691-88364713 CAGATCGAGGAGGAAAGGGAAGG - Intergenic
1194508368 X:94761392-94761414 CAGATAATTGAGAAACAGGATGG + Intergenic
1194764104 X:97829300-97829322 GAGATCAGGGAGAAGGAGGAAGG - Intergenic
1194774883 X:97949907-97949929 CATATGAAGAACAAAGAGGAAGG + Intergenic
1195018625 X:100802812-100802834 AAGATCAGGAAGAAAGAAGATGG + Intergenic
1195273702 X:103257625-103257647 AGGATCTAGGAGGAAGAGGAGGG - Intergenic
1195707789 X:107750575-107750597 CAGAACAAGGAGAGAGAGCTGGG + Intronic
1195832971 X:109080516-109080538 TAAAACAAGGAGAAAGTGGAAGG - Intergenic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196177969 X:112661036-112661058 CAGACCAAGGCAAAAGAGGTTGG - Intronic
1196274675 X:113752849-113752871 CATATCAATGAAAAAGAGAAAGG - Intergenic
1196345624 X:114653645-114653667 ATGAACAAGGAGAAACAGGAGGG - Intronic
1196345916 X:114658690-114658712 CAGATAAAGGGGGGAGAGGAGGG + Intronic
1197698080 X:129572412-129572434 CAAATCAAAGATAATGAGGAGGG - Intronic
1197856798 X:130921751-130921773 GAGAAAAAGGAGGAAGAGGAAGG - Intergenic
1197868373 X:131042439-131042461 CAGAGTCTGGAGAAAGAGGATGG + Intergenic
1198036084 X:132802844-132802866 GAGATCAAGCAGAAGGGGGAAGG + Intronic
1198080616 X:133235957-133235979 CAGAGCAACAGGAAAGAGGAAGG - Intergenic
1199781195 X:151061576-151061598 GATATCAAAGAGCAAGAGGAGGG + Intergenic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200686456 Y:6263948-6263970 CAGATCAAGGAGAAAGAGGATGG + Intergenic
1200989330 Y:9334865-9334887 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1200991999 Y:9355195-9355217 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1200994653 Y:9375475-9375497 CGGATCAAGGAGAAAGAGGATGG + Intronic
1200997316 Y:9395821-9395843 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1200999831 Y:9464358-9464380 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1201002489 Y:9484667-9484689 CGGATCAAGGAGAAAGAGGATGG + Intronic
1201005149 Y:9504954-9504976 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1201007807 Y:9525281-9525303 CGGATCAAGGAGAAAGAGGATGG + Intergenic
1201010424 Y:9545471-9545493 CTGATCAAGGAGAAAGAGGAGGG + Intergenic
1201454031 Y:14148592-14148614 CACATAAAGGAGAGAGGGGAAGG - Intergenic
1202594608 Y:26523260-26523282 TACATAAAGGAGAAAGAGAAAGG + Intergenic