ID: 1200687398

View in Genome Browser
Species Human (GRCh38)
Location Y:6268586-6268608
Sequence TCCAGGACATTAACGGCATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200687394_1200687398 6 Left 1200687394 Y:6268557-6268579 CCTTGAGAGAAAGACAGAGAGTG No data
Right 1200687398 Y:6268586-6268608 TCCAGGACATTAACGGCATTGGG No data
1200687393_1200687398 27 Left 1200687393 Y:6268536-6268558 CCTTTCATACATGTAGAAATTCC No data
Right 1200687398 Y:6268586-6268608 TCCAGGACATTAACGGCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200687398 Original CRISPR TCCAGGACATTAACGGCATT GGG Intergenic
No off target data available for this crispr