ID: 1200691282

View in Genome Browser
Species Human (GRCh38)
Location Y:6307670-6307692
Sequence ATCAAGAAGAAGAAAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200691282_1200691289 17 Left 1200691282 Y:6307670-6307692 CCATCCTCTTTCTTCTTCTTGAT No data
Right 1200691289 Y:6307710-6307732 TCAGTCATCCTGGTTACCGGCGG No data
1200691282_1200691286 -9 Left 1200691282 Y:6307670-6307692 CCATCCTCTTTCTTCTTCTTGAT No data
Right 1200691286 Y:6307684-6307706 CTTCTTGATCAGACAGGTGGAGG No data
1200691282_1200691288 14 Left 1200691282 Y:6307670-6307692 CCATCCTCTTTCTTCTTCTTGAT No data
Right 1200691288 Y:6307707-6307729 AACTCAGTCATCCTGGTTACCGG No data
1200691282_1200691287 7 Left 1200691282 Y:6307670-6307692 CCATCCTCTTTCTTCTTCTTGAT No data
Right 1200691287 Y:6307700-6307722 GTGGAGGAACTCAGTCATCCTGG No data
1200691282_1200691290 21 Left 1200691282 Y:6307670-6307692 CCATCCTCTTTCTTCTTCTTGAT No data
Right 1200691290 Y:6307714-6307736 TCATCCTGGTTACCGGCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200691282 Original CRISPR ATCAAGAAGAAGAAAGAGGA TGG (reversed) Intergenic
No off target data available for this crispr