ID: 1200695604

View in Genome Browser
Species Human (GRCh38)
Location Y:6355985-6356007
Sequence TCTGATATTCAGCCTGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200695604_1200695610 -1 Left 1200695604 Y:6355985-6356007 CCATCCCCAGGCTGAATATCAGA No data
Right 1200695610 Y:6356007-6356029 AGGCAGTTTAGGCAGTTTAGTGG No data
1200695604_1200695612 18 Left 1200695604 Y:6355985-6356007 CCATCCCCAGGCTGAATATCAGA No data
Right 1200695612 Y:6356026-6356048 GTGGTTAAGGATGAAGTTGCTGG No data
1200695604_1200695611 5 Left 1200695604 Y:6355985-6356007 CCATCCCCAGGCTGAATATCAGA No data
Right 1200695611 Y:6356013-6356035 TTTAGGCAGTTTAGTGGTTAAGG No data
1200695604_1200695613 28 Left 1200695604 Y:6355985-6356007 CCATCCCCAGGCTGAATATCAGA No data
Right 1200695613 Y:6356036-6356058 ATGAAGTTGCTGGCTCTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200695604 Original CRISPR TCTGATATTCAGCCTGGGGA TGG (reversed) Intergenic
No off target data available for this crispr