ID: 1200695905

View in Genome Browser
Species Human (GRCh38)
Location Y:6359352-6359374
Sequence CAGGGAAATAAGAAGACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200695905_1200695911 7 Left 1200695905 Y:6359352-6359374 CCAGGTGTCTTCTTATTTCCCTG No data
Right 1200695911 Y:6359382-6359404 GGCTAGCATAACTCAAATAGTGG No data
1200695905_1200695914 15 Left 1200695905 Y:6359352-6359374 CCAGGTGTCTTCTTATTTCCCTG No data
Right 1200695914 Y:6359390-6359412 TAACTCAAATAGTGGAGGTTGGG No data
1200695905_1200695912 10 Left 1200695905 Y:6359352-6359374 CCAGGTGTCTTCTTATTTCCCTG No data
Right 1200695912 Y:6359385-6359407 TAGCATAACTCAAATAGTGGAGG No data
1200695905_1200695913 14 Left 1200695905 Y:6359352-6359374 CCAGGTGTCTTCTTATTTCCCTG No data
Right 1200695913 Y:6359389-6359411 ATAACTCAAATAGTGGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200695905 Original CRISPR CAGGGAAATAAGAAGACACC TGG (reversed) Intergenic
No off target data available for this crispr