ID: 1200695908

View in Genome Browser
Species Human (GRCh38)
Location Y:6359370-6359392
Sequence TTATGCTAGCCATGGCACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200695908_1200695912 -8 Left 1200695908 Y:6359370-6359392 CCCTGGTGCCATGGCTAGCATAA No data
Right 1200695912 Y:6359385-6359407 TAGCATAACTCAAATAGTGGAGG No data
1200695908_1200695913 -4 Left 1200695908 Y:6359370-6359392 CCCTGGTGCCATGGCTAGCATAA No data
Right 1200695913 Y:6359389-6359411 ATAACTCAAATAGTGGAGGTTGG No data
1200695908_1200695914 -3 Left 1200695908 Y:6359370-6359392 CCCTGGTGCCATGGCTAGCATAA No data
Right 1200695914 Y:6359390-6359412 TAACTCAAATAGTGGAGGTTGGG No data
1200695908_1200695915 14 Left 1200695908 Y:6359370-6359392 CCCTGGTGCCATGGCTAGCATAA No data
Right 1200695915 Y:6359407-6359429 GTTGGGCTGCTGAGATCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200695908 Original CRISPR TTATGCTAGCCATGGCACCA GGG (reversed) Intergenic