ID: 1200695909

View in Genome Browser
Species Human (GRCh38)
Location Y:6359371-6359393
Sequence GTTATGCTAGCCATGGCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200695909_1200695912 -9 Left 1200695909 Y:6359371-6359393 CCTGGTGCCATGGCTAGCATAAC No data
Right 1200695912 Y:6359385-6359407 TAGCATAACTCAAATAGTGGAGG No data
1200695909_1200695915 13 Left 1200695909 Y:6359371-6359393 CCTGGTGCCATGGCTAGCATAAC No data
Right 1200695915 Y:6359407-6359429 GTTGGGCTGCTGAGATCCTCAGG No data
1200695909_1200695914 -4 Left 1200695909 Y:6359371-6359393 CCTGGTGCCATGGCTAGCATAAC No data
Right 1200695914 Y:6359390-6359412 TAACTCAAATAGTGGAGGTTGGG No data
1200695909_1200695913 -5 Left 1200695909 Y:6359371-6359393 CCTGGTGCCATGGCTAGCATAAC No data
Right 1200695913 Y:6359389-6359411 ATAACTCAAATAGTGGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200695909 Original CRISPR GTTATGCTAGCCATGGCACC AGG (reversed) Intergenic