ID: 1200695911

View in Genome Browser
Species Human (GRCh38)
Location Y:6359382-6359404
Sequence GGCTAGCATAACTCAAATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200695905_1200695911 7 Left 1200695905 Y:6359352-6359374 CCAGGTGTCTTCTTATTTCCCTG No data
Right 1200695911 Y:6359382-6359404 GGCTAGCATAACTCAAATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200695911 Original CRISPR GGCTAGCATAACTCAAATAG TGG Intergenic
No off target data available for this crispr