ID: 1200695913

View in Genome Browser
Species Human (GRCh38)
Location Y:6359389-6359411
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200695909_1200695913 -5 Left 1200695909 Y:6359371-6359393 CCTGGTGCCATGGCTAGCATAAC No data
Right 1200695913 Y:6359389-6359411 ATAACTCAAATAGTGGAGGTTGG No data
1200695905_1200695913 14 Left 1200695905 Y:6359352-6359374 CCAGGTGTCTTCTTATTTCCCTG No data
Right 1200695913 Y:6359389-6359411 ATAACTCAAATAGTGGAGGTTGG No data
1200695908_1200695913 -4 Left 1200695908 Y:6359370-6359392 CCCTGGTGCCATGGCTAGCATAA No data
Right 1200695913 Y:6359389-6359411 ATAACTCAAATAGTGGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200695913 Original CRISPR ATAACTCAAATAGTGGAGGT TGG Intergenic