ID: 1200695915

View in Genome Browser
Species Human (GRCh38)
Location Y:6359407-6359429
Sequence GTTGGGCTGCTGAGATCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200695910_1200695915 6 Left 1200695910 Y:6359378-6359400 CCATGGCTAGCATAACTCAAATA No data
Right 1200695915 Y:6359407-6359429 GTTGGGCTGCTGAGATCCTCAGG No data
1200695909_1200695915 13 Left 1200695909 Y:6359371-6359393 CCTGGTGCCATGGCTAGCATAAC No data
Right 1200695915 Y:6359407-6359429 GTTGGGCTGCTGAGATCCTCAGG No data
1200695908_1200695915 14 Left 1200695908 Y:6359370-6359392 CCCTGGTGCCATGGCTAGCATAA No data
Right 1200695915 Y:6359407-6359429 GTTGGGCTGCTGAGATCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200695915 Original CRISPR GTTGGGCTGCTGAGATCCTC AGG Intergenic
No off target data available for this crispr