ID: 1200703520

View in Genome Browser
Species Human (GRCh38)
Location Y:6422196-6422218
Sequence CACCGTTATCAGAGGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200703520_1200703525 4 Left 1200703520 Y:6422196-6422218 CCTGCAGCCCTCTGATAACGGTG No data
Right 1200703525 Y:6422223-6422245 AACAAAAGTTTCCCTGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200703520 Original CRISPR CACCGTTATCAGAGGGCTGC AGG (reversed) Intergenic
No off target data available for this crispr