ID: 1200705492 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:6439035-6439057 |
| Sequence | CTGACTATGCTGTAGGTTGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1200705492_1200705495 | -2 | Left | 1200705492 | Y:6439035-6439057 | CCCACAACCTACAGCATAGTCAG | No data | ||
| Right | 1200705495 | Y:6439056-6439078 | AGCATAGAAAAAATCCTTTTTGG | No data | ||||
| 1200705492_1200705497 | 14 | Left | 1200705492 | Y:6439035-6439057 | CCCACAACCTACAGCATAGTCAG | No data | ||
| Right | 1200705497 | Y:6439072-6439094 | TTTTTGGTTCCTGAAGTTTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1200705492 | Original CRISPR | CTGACTATGCTGTAGGTTGT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||