ID: 1200705492

View in Genome Browser
Species Human (GRCh38)
Location Y:6439035-6439057
Sequence CTGACTATGCTGTAGGTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200705492_1200705495 -2 Left 1200705492 Y:6439035-6439057 CCCACAACCTACAGCATAGTCAG No data
Right 1200705495 Y:6439056-6439078 AGCATAGAAAAAATCCTTTTTGG No data
1200705492_1200705497 14 Left 1200705492 Y:6439035-6439057 CCCACAACCTACAGCATAGTCAG No data
Right 1200705497 Y:6439072-6439094 TTTTTGGTTCCTGAAGTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200705492 Original CRISPR CTGACTATGCTGTAGGTTGT GGG (reversed) Intergenic
No off target data available for this crispr