ID: 1200705821

View in Genome Browser
Species Human (GRCh38)
Location Y:6441605-6441627
Sequence CTGCCTATGCTCAAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200705821_1200705828 28 Left 1200705821 Y:6441605-6441627 CCCACCTCCTTGAGCATAGGCAG No data
Right 1200705828 Y:6441656-6441678 AATCACTGGCAGCTAATCTGTGG No data
1200705821_1200705827 14 Left 1200705821 Y:6441605-6441627 CCCACCTCCTTGAGCATAGGCAG No data
Right 1200705827 Y:6441642-6441664 CATTTGCTGTTTGAAATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200705821 Original CRISPR CTGCCTATGCTCAAGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr