ID: 1200706551

View in Genome Browser
Species Human (GRCh38)
Location Y:6447819-6447841
Sequence CCTGAAGGGTCCCTGAGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200706551_1200706559 -6 Left 1200706551 Y:6447819-6447841 CCCGACCTCAGGGACCCTTCAGG No data
Right 1200706559 Y:6447836-6447858 TTCAGGCCATCGTGGTGGTTAGG No data
1200706551_1200706561 3 Left 1200706551 Y:6447819-6447841 CCCGACCTCAGGGACCCTTCAGG No data
Right 1200706561 Y:6447845-6447867 TCGTGGTGGTTAGGTTCTGCTGG No data
1200706551_1200706563 9 Left 1200706551 Y:6447819-6447841 CCCGACCTCAGGGACCCTTCAGG No data
Right 1200706563 Y:6447851-6447873 TGGTTAGGTTCTGCTGGAGGAGG No data
1200706551_1200706565 30 Left 1200706551 Y:6447819-6447841 CCCGACCTCAGGGACCCTTCAGG No data
Right 1200706565 Y:6447872-6447894 GGAGGCATTTTGTGACTGTGAGG No data
1200706551_1200706564 12 Left 1200706551 Y:6447819-6447841 CCCGACCTCAGGGACCCTTCAGG No data
Right 1200706564 Y:6447854-6447876 TTAGGTTCTGCTGGAGGAGGAGG No data
1200706551_1200706562 6 Left 1200706551 Y:6447819-6447841 CCCGACCTCAGGGACCCTTCAGG No data
Right 1200706562 Y:6447848-6447870 TGGTGGTTAGGTTCTGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200706551 Original CRISPR CCTGAAGGGTCCCTGAGGTC GGG (reversed) Intergenic
No off target data available for this crispr