ID: 1200708039

View in Genome Browser
Species Human (GRCh38)
Location Y:6459388-6459410
Sequence GCATTTCAAGTTGTGGATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200708039_1200708041 -5 Left 1200708039 Y:6459388-6459410 CCATGATCCACAACTTGAAATGC No data
Right 1200708041 Y:6459406-6459428 AATGCAGCCAGCCTACCTGAAGG No data
1200708039_1200708047 20 Left 1200708039 Y:6459388-6459410 CCATGATCCACAACTTGAAATGC No data
Right 1200708047 Y:6459431-6459453 CTTTTGCTCCCTAAAATCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200708039 Original CRISPR GCATTTCAAGTTGTGGATCA TGG (reversed) Intergenic
No off target data available for this crispr