ID: 1200709922

View in Genome Browser
Species Human (GRCh38)
Location Y:6474113-6474135
Sequence AGGTGTCTGCAAAAGATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200709917_1200709922 -6 Left 1200709917 Y:6474096-6474118 CCTGAGACCCCAGAGGCAGGTGT No data
Right 1200709922 Y:6474113-6474135 AGGTGTCTGCAAAAGATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200709922 Original CRISPR AGGTGTCTGCAAAAGATGGC TGG Intergenic
No off target data available for this crispr