ID: 1200718271

View in Genome Browser
Species Human (GRCh38)
Location Y:6574993-6575015
Sequence CAAAATGCTGATAGTGATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200718267_1200718271 4 Left 1200718267 Y:6574966-6574988 CCTAGAGACTTGTCGAATGGCTT 0: 21
1: 1493
2: 1912
3: 1413
4: 823
Right 1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200718271 Original CRISPR CAAAATGCTGATAGTGATAG GGG Intergenic
No off target data available for this crispr