ID: 1200727208

View in Genome Browser
Species Human (GRCh38)
Location Y:6686292-6686314
Sequence AAGGCTCCTCTCCCATTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200727200_1200727208 25 Left 1200727200 Y:6686244-6686266 CCAGGTCAGGAACCTGCATGTCT No data
Right 1200727208 Y:6686292-6686314 AAGGCTCCTCTCCCATTTGAGGG No data
1200727201_1200727208 13 Left 1200727201 Y:6686256-6686278 CCTGCATGTCTCATCCCTCTCAG No data
Right 1200727208 Y:6686292-6686314 AAGGCTCCTCTCCCATTTGAGGG No data
1200727199_1200727208 30 Left 1200727199 Y:6686239-6686261 CCACTCCAGGTCAGGAACCTGCA No data
Right 1200727208 Y:6686292-6686314 AAGGCTCCTCTCCCATTTGAGGG No data
1200727205_1200727208 -2 Left 1200727205 Y:6686271-6686293 CCTCTCAGTGCTCTGAGGGCGAA No data
Right 1200727208 Y:6686292-6686314 AAGGCTCCTCTCCCATTTGAGGG No data
1200727204_1200727208 -1 Left 1200727204 Y:6686270-6686292 CCCTCTCAGTGCTCTGAGGGCGA No data
Right 1200727208 Y:6686292-6686314 AAGGCTCCTCTCCCATTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200727208 Original CRISPR AAGGCTCCTCTCCCATTTGA GGG Intergenic
No off target data available for this crispr