ID: 1200728351

View in Genome Browser
Species Human (GRCh38)
Location Y:6702014-6702036
Sequence TGCAGGTTCCTGACCTGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200728351_1200728354 4 Left 1200728351 Y:6702014-6702036 CCACTCCAGGTCAGGAACCTGCA No data
Right 1200728354 Y:6702041-6702063 TCATCCCTCTCAGTGCTCTGAGG No data
1200728351_1200728360 30 Left 1200728351 Y:6702014-6702036 CCACTCCAGGTCAGGAACCTGCA No data
Right 1200728360 Y:6702067-6702089 AAGGCTCCTCTCCCATTTGAGGG No data
1200728351_1200728359 29 Left 1200728351 Y:6702014-6702036 CCACTCCAGGTCAGGAACCTGCA No data
Right 1200728359 Y:6702066-6702088 GAAGGCTCCTCTCCCATTTGAGG No data
1200728351_1200728358 11 Left 1200728351 Y:6702014-6702036 CCACTCCAGGTCAGGAACCTGCA No data
Right 1200728358 Y:6702048-6702070 TCTCAGTGCTCTGAGGGCGAAGG No data
1200728351_1200728355 5 Left 1200728351 Y:6702014-6702036 CCACTCCAGGTCAGGAACCTGCA No data
Right 1200728355 Y:6702042-6702064 CATCCCTCTCAGTGCTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200728351 Original CRISPR TGCAGGTTCCTGACCTGGAG TGG (reversed) Intergenic