ID: 1200728352

View in Genome Browser
Species Human (GRCh38)
Location Y:6702019-6702041
Sequence AGACATGCAGGTTCCTGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200728352_1200728359 24 Left 1200728352 Y:6702019-6702041 CCAGGTCAGGAACCTGCATGTCT No data
Right 1200728359 Y:6702066-6702088 GAAGGCTCCTCTCCCATTTGAGG No data
1200728352_1200728355 0 Left 1200728352 Y:6702019-6702041 CCAGGTCAGGAACCTGCATGTCT No data
Right 1200728355 Y:6702042-6702064 CATCCCTCTCAGTGCTCTGAGGG No data
1200728352_1200728361 29 Left 1200728352 Y:6702019-6702041 CCAGGTCAGGAACCTGCATGTCT No data
Right 1200728361 Y:6702071-6702093 CTCCTCTCCCATTTGAGGGTCGG No data
1200728352_1200728354 -1 Left 1200728352 Y:6702019-6702041 CCAGGTCAGGAACCTGCATGTCT No data
Right 1200728354 Y:6702041-6702063 TCATCCCTCTCAGTGCTCTGAGG No data
1200728352_1200728360 25 Left 1200728352 Y:6702019-6702041 CCAGGTCAGGAACCTGCATGTCT No data
Right 1200728360 Y:6702067-6702089 AAGGCTCCTCTCCCATTTGAGGG No data
1200728352_1200728358 6 Left 1200728352 Y:6702019-6702041 CCAGGTCAGGAACCTGCATGTCT No data
Right 1200728358 Y:6702048-6702070 TCTCAGTGCTCTGAGGGCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200728352 Original CRISPR AGACATGCAGGTTCCTGACC TGG (reversed) Intergenic