ID: 1200728353

View in Genome Browser
Species Human (GRCh38)
Location Y:6702031-6702053
Sequence CTGAGAGGGATGAGACATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200728353_1200728361 17 Left 1200728353 Y:6702031-6702053 CCTGCATGTCTCATCCCTCTCAG No data
Right 1200728361 Y:6702071-6702093 CTCCTCTCCCATTTGAGGGTCGG No data
1200728353_1200728360 13 Left 1200728353 Y:6702031-6702053 CCTGCATGTCTCATCCCTCTCAG No data
Right 1200728360 Y:6702067-6702089 AAGGCTCCTCTCCCATTTGAGGG No data
1200728353_1200728364 24 Left 1200728353 Y:6702031-6702053 CCTGCATGTCTCATCCCTCTCAG No data
Right 1200728364 Y:6702078-6702100 CCCATTTGAGGGTCGGCCACAGG No data
1200728353_1200728359 12 Left 1200728353 Y:6702031-6702053 CCTGCATGTCTCATCCCTCTCAG No data
Right 1200728359 Y:6702066-6702088 GAAGGCTCCTCTCCCATTTGAGG No data
1200728353_1200728358 -6 Left 1200728353 Y:6702031-6702053 CCTGCATGTCTCATCCCTCTCAG No data
Right 1200728358 Y:6702048-6702070 TCTCAGTGCTCTGAGGGCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200728353 Original CRISPR CTGAGAGGGATGAGACATGC AGG (reversed) Intergenic