ID: 1200728356

View in Genome Browser
Species Human (GRCh38)
Location Y:6702045-6702067
Sequence TCGCCCTCAGAGCACTGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200728356_1200728361 3 Left 1200728356 Y:6702045-6702067 CCCTCTCAGTGCTCTGAGGGCGA No data
Right 1200728361 Y:6702071-6702093 CTCCTCTCCCATTTGAGGGTCGG No data
1200728356_1200728364 10 Left 1200728356 Y:6702045-6702067 CCCTCTCAGTGCTCTGAGGGCGA No data
Right 1200728364 Y:6702078-6702100 CCCATTTGAGGGTCGGCCACAGG No data
1200728356_1200728360 -1 Left 1200728356 Y:6702045-6702067 CCCTCTCAGTGCTCTGAGGGCGA No data
Right 1200728360 Y:6702067-6702089 AAGGCTCCTCTCCCATTTGAGGG No data
1200728356_1200728359 -2 Left 1200728356 Y:6702045-6702067 CCCTCTCAGTGCTCTGAGGGCGA No data
Right 1200728359 Y:6702066-6702088 GAAGGCTCCTCTCCCATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200728356 Original CRISPR TCGCCCTCAGAGCACTGAGA GGG (reversed) Intergenic