ID: 1200728360

View in Genome Browser
Species Human (GRCh38)
Location Y:6702067-6702089
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200728352_1200728360 25 Left 1200728352 Y:6702019-6702041 CCAGGTCAGGAACCTGCATGTCT No data
Right 1200728360 Y:6702067-6702089 AAGGCTCCTCTCCCATTTGAGGG No data
1200728353_1200728360 13 Left 1200728353 Y:6702031-6702053 CCTGCATGTCTCATCCCTCTCAG No data
Right 1200728360 Y:6702067-6702089 AAGGCTCCTCTCCCATTTGAGGG No data
1200728356_1200728360 -1 Left 1200728356 Y:6702045-6702067 CCCTCTCAGTGCTCTGAGGGCGA No data
Right 1200728360 Y:6702067-6702089 AAGGCTCCTCTCCCATTTGAGGG No data
1200728357_1200728360 -2 Left 1200728357 Y:6702046-6702068 CCTCTCAGTGCTCTGAGGGCGAA No data
Right 1200728360 Y:6702067-6702089 AAGGCTCCTCTCCCATTTGAGGG No data
1200728351_1200728360 30 Left 1200728351 Y:6702014-6702036 CCACTCCAGGTCAGGAACCTGCA No data
Right 1200728360 Y:6702067-6702089 AAGGCTCCTCTCCCATTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200728360 Original CRISPR AAGGCTCCTCTCCCATTTGA GGG Intergenic