ID: 1200728364

View in Genome Browser
Species Human (GRCh38)
Location Y:6702078-6702100
Sequence CCCATTTGAGGGTCGGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200728356_1200728364 10 Left 1200728356 Y:6702045-6702067 CCCTCTCAGTGCTCTGAGGGCGA No data
Right 1200728364 Y:6702078-6702100 CCCATTTGAGGGTCGGCCACAGG No data
1200728353_1200728364 24 Left 1200728353 Y:6702031-6702053 CCTGCATGTCTCATCCCTCTCAG No data
Right 1200728364 Y:6702078-6702100 CCCATTTGAGGGTCGGCCACAGG No data
1200728357_1200728364 9 Left 1200728357 Y:6702046-6702068 CCTCTCAGTGCTCTGAGGGCGAA No data
Right 1200728364 Y:6702078-6702100 CCCATTTGAGGGTCGGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200728364 Original CRISPR CCCATTTGAGGGTCGGCCAC AGG Intergenic