ID: 1200731977

View in Genome Browser
Species Human (GRCh38)
Location Y:6752540-6752562
Sequence AGATATCAGCCCCTATTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200731977_1200731984 16 Left 1200731977 Y:6752540-6752562 CCTCCTAATAGGGGCTGATATCT No data
Right 1200731984 Y:6752579-6752601 CTGTCCATAAATCCCTGGGTGGG No data
1200731977_1200731981 11 Left 1200731977 Y:6752540-6752562 CCTCCTAATAGGGGCTGATATCT No data
Right 1200731981 Y:6752574-6752596 GAGTTCTGTCCATAAATCCCTGG No data
1200731977_1200731983 15 Left 1200731977 Y:6752540-6752562 CCTCCTAATAGGGGCTGATATCT No data
Right 1200731983 Y:6752578-6752600 TCTGTCCATAAATCCCTGGGTGG No data
1200731977_1200731982 12 Left 1200731977 Y:6752540-6752562 CCTCCTAATAGGGGCTGATATCT No data
Right 1200731982 Y:6752575-6752597 AGTTCTGTCCATAAATCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200731977 Original CRISPR AGATATCAGCCCCTATTAGG AGG (reversed) Intergenic
No off target data available for this crispr