ID: 1200732569

View in Genome Browser
Species Human (GRCh38)
Location Y:6758398-6758420
Sequence GCAGCCAGGAAGTTCAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200732569_1200732574 28 Left 1200732569 Y:6758398-6758420 CCCAGTTTGAACTTCCTGGCTGC No data
Right 1200732574 Y:6758449-6758471 TACTCAAGCCTCAGCAATGATGG 0: 29
1: 1106
2: 1356
3: 919
4: 937
1200732569_1200732572 -5 Left 1200732569 Y:6758398-6758420 CCCAGTTTGAACTTCCTGGCTGC No data
Right 1200732572 Y:6758416-6758438 GCTGCTTTGTTTACACTGTGAGG 0: 10
1: 236
2: 552
3: 440
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200732569 Original CRISPR GCAGCCAGGAAGTTCAAACT GGG (reversed) Intergenic
No off target data available for this crispr