ID: 1200732571

View in Genome Browser
Species Human (GRCh38)
Location Y:6758412-6758434
Sequence ACAGTGTAAACAAAGCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3016
Summary {0: 12, 1: 198, 2: 559, 3: 614, 4: 1633}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200732571_1200732574 14 Left 1200732571 Y:6758412-6758434 CCTGGCTGCTTTGTTTACACTGT 0: 12
1: 198
2: 559
3: 614
4: 1633
Right 1200732574 Y:6758449-6758471 TACTCAAGCCTCAGCAATGATGG 0: 29
1: 1106
2: 1356
3: 919
4: 937

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200732571 Original CRISPR ACAGTGTAAACAAAGCAGCC AGG (reversed) Intergenic
Too many off-targets to display for this crispr