ID: 1200732574

View in Genome Browser
Species Human (GRCh38)
Location Y:6758449-6758471
Sequence TACTCAAGCCTCAGCAATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4347
Summary {0: 29, 1: 1106, 2: 1356, 3: 919, 4: 937}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200732569_1200732574 28 Left 1200732569 Y:6758398-6758420 CCCAGTTTGAACTTCCTGGCTGC No data
Right 1200732574 Y:6758449-6758471 TACTCAAGCCTCAGCAATGATGG 0: 29
1: 1106
2: 1356
3: 919
4: 937
1200732571_1200732574 14 Left 1200732571 Y:6758412-6758434 CCTGGCTGCTTTGTTTACACTGT 0: 12
1: 198
2: 559
3: 614
4: 1633
Right 1200732574 Y:6758449-6758471 TACTCAAGCCTCAGCAATGATGG 0: 29
1: 1106
2: 1356
3: 919
4: 937
1200732570_1200732574 27 Left 1200732570 Y:6758399-6758421 CCAGTTTGAACTTCCTGGCTGCT No data
Right 1200732574 Y:6758449-6758471 TACTCAAGCCTCAGCAATGATGG 0: 29
1: 1106
2: 1356
3: 919
4: 937

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200732574 Original CRISPR TACTCAAGCCTCAGCAATGA TGG Intergenic
Too many off-targets to display for this crispr