ID: 1200734262

View in Genome Browser
Species Human (GRCh38)
Location Y:6776853-6776875
Sequence TTAAAATAAAAGAAGCAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200734262_1200734268 25 Left 1200734262 Y:6776853-6776875 CCCCATTGCTTCTTTTATTTTAA No data
Right 1200734268 Y:6776901-6776923 TTGCCCTTTTAGAATAGTGAAGG No data
1200734262_1200734266 -10 Left 1200734262 Y:6776853-6776875 CCCCATTGCTTCTTTTATTTTAA No data
Right 1200734266 Y:6776866-6776888 TTTATTTTAAATCATGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200734262 Original CRISPR TTAAAATAAAAGAAGCAATG GGG (reversed) Intergenic
No off target data available for this crispr