ID: 1200734264

View in Genome Browser
Species Human (GRCh38)
Location Y:6776855-6776877
Sequence ATTTAAAATAAAAGAAGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200734264_1200734268 23 Left 1200734264 Y:6776855-6776877 CCATTGCTTCTTTTATTTTAAAT No data
Right 1200734268 Y:6776901-6776923 TTGCCCTTTTAGAATAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200734264 Original CRISPR ATTTAAAATAAAAGAAGCAA TGG (reversed) Intergenic
No off target data available for this crispr