ID: 1200737265

View in Genome Browser
Species Human (GRCh38)
Location Y:6813226-6813248
Sequence CTCTAATAAGAGTCTGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200737258_1200737265 -3 Left 1200737258 Y:6813206-6813228 CCAAGCCCTGCCAGGTGGTCCTC No data
Right 1200737265 Y:6813226-6813248 CTCTAATAAGAGTCTGGACAGGG No data
1200737259_1200737265 -8 Left 1200737259 Y:6813211-6813233 CCCTGCCAGGTGGTCCTCTAATA No data
Right 1200737265 Y:6813226-6813248 CTCTAATAAGAGTCTGGACAGGG No data
1200737257_1200737265 -2 Left 1200737257 Y:6813205-6813227 CCCAAGCCCTGCCAGGTGGTCCT No data
Right 1200737265 Y:6813226-6813248 CTCTAATAAGAGTCTGGACAGGG No data
1200737260_1200737265 -9 Left 1200737260 Y:6813212-6813234 CCTGCCAGGTGGTCCTCTAATAA No data
Right 1200737265 Y:6813226-6813248 CTCTAATAAGAGTCTGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200737265 Original CRISPR CTCTAATAAGAGTCTGGACA GGG Intergenic
No off target data available for this crispr