ID: 1200738058

View in Genome Browser
Species Human (GRCh38)
Location Y:6821743-6821765
Sequence TTGGGGAAACAGATGGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200738053_1200738058 11 Left 1200738053 Y:6821709-6821731 CCTTTTTAAAATTATTGTTATTA No data
Right 1200738058 Y:6821743-6821765 TTGGGGAAACAGATGGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200738058 Original CRISPR TTGGGGAAACAGATGGTGTT TGG Intergenic
No off target data available for this crispr