ID: 1200738589

View in Genome Browser
Species Human (GRCh38)
Location Y:6828636-6828658
Sequence GCTCAATTGAAAGGCTGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200738589_1200738597 17 Left 1200738589 Y:6828636-6828658 CCTTTGCAGCCTTTCAATTGAGC No data
Right 1200738597 Y:6828676-6828698 GTGCTAGACATGATGCTGGGTGG No data
1200738589_1200738596 14 Left 1200738589 Y:6828636-6828658 CCTTTGCAGCCTTTCAATTGAGC No data
Right 1200738596 Y:6828673-6828695 CCTGTGCTAGACATGATGCTGGG No data
1200738589_1200738594 13 Left 1200738589 Y:6828636-6828658 CCTTTGCAGCCTTTCAATTGAGC No data
Right 1200738594 Y:6828672-6828694 CCCTGTGCTAGACATGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200738589 Original CRISPR GCTCAATTGAAAGGCTGCAA AGG (reversed) Intergenic
No off target data available for this crispr