ID: 1200738594

View in Genome Browser
Species Human (GRCh38)
Location Y:6828672-6828694
Sequence CCCTGTGCTAGACATGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200738592_1200738594 4 Left 1200738592 Y:6828645-6828667 CCTTTCAATTGAGCTGTGGGAAA No data
Right 1200738594 Y:6828672-6828694 CCCTGTGCTAGACATGATGCTGG No data
1200738588_1200738594 28 Left 1200738588 Y:6828621-6828643 CCTTATTGCATGTTACCTTTGCA No data
Right 1200738594 Y:6828672-6828694 CCCTGTGCTAGACATGATGCTGG No data
1200738589_1200738594 13 Left 1200738589 Y:6828636-6828658 CCTTTGCAGCCTTTCAATTGAGC No data
Right 1200738594 Y:6828672-6828694 CCCTGTGCTAGACATGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200738594 Original CRISPR CCCTGTGCTAGACATGATGC TGG Intergenic
No off target data available for this crispr