ID: 1200746057

View in Genome Browser
Species Human (GRCh38)
Location Y:6904866-6904888
Sequence GATAGCTCTTGGCTTATTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200746057_1200746060 11 Left 1200746057 Y:6904866-6904888 CCAGTAATAAGCCAAGAGCTATC No data
Right 1200746060 Y:6904900-6904922 CAGTAGTTACCCACAGAAGATGG No data
1200746057_1200746062 16 Left 1200746057 Y:6904866-6904888 CCAGTAATAAGCCAAGAGCTATC No data
Right 1200746062 Y:6904905-6904927 GTTACCCACAGAAGATGGCAGGG No data
1200746057_1200746061 15 Left 1200746057 Y:6904866-6904888 CCAGTAATAAGCCAAGAGCTATC No data
Right 1200746061 Y:6904904-6904926 AGTTACCCACAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200746057 Original CRISPR GATAGCTCTTGGCTTATTAC TGG (reversed) Intergenic
No off target data available for this crispr