ID: 1200746060

View in Genome Browser
Species Human (GRCh38)
Location Y:6904900-6904922
Sequence CAGTAGTTACCCACAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200746057_1200746060 11 Left 1200746057 Y:6904866-6904888 CCAGTAATAAGCCAAGAGCTATC No data
Right 1200746060 Y:6904900-6904922 CAGTAGTTACCCACAGAAGATGG No data
1200746059_1200746060 0 Left 1200746059 Y:6904877-6904899 CCAAGAGCTATCGCTCAAAAGGA No data
Right 1200746060 Y:6904900-6904922 CAGTAGTTACCCACAGAAGATGG No data
1200746054_1200746060 19 Left 1200746054 Y:6904858-6904880 CCCAAAGCCCAGTAATAAGCCAA No data
Right 1200746060 Y:6904900-6904922 CAGTAGTTACCCACAGAAGATGG No data
1200746052_1200746060 21 Left 1200746052 Y:6904856-6904878 CCCCCAAAGCCCAGTAATAAGCC No data
Right 1200746060 Y:6904900-6904922 CAGTAGTTACCCACAGAAGATGG No data
1200746053_1200746060 20 Left 1200746053 Y:6904857-6904879 CCCCAAAGCCCAGTAATAAGCCA No data
Right 1200746060 Y:6904900-6904922 CAGTAGTTACCCACAGAAGATGG No data
1200746056_1200746060 12 Left 1200746056 Y:6904865-6904887 CCCAGTAATAAGCCAAGAGCTAT No data
Right 1200746060 Y:6904900-6904922 CAGTAGTTACCCACAGAAGATGG No data
1200746055_1200746060 18 Left 1200746055 Y:6904859-6904881 CCAAAGCCCAGTAATAAGCCAAG No data
Right 1200746060 Y:6904900-6904922 CAGTAGTTACCCACAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200746060 Original CRISPR CAGTAGTTACCCACAGAAGA TGG Intergenic
No off target data available for this crispr