ID: 1200747545

View in Genome Browser
Species Human (GRCh38)
Location Y:6915792-6915814
Sequence CCGGACTCCCAGCAGAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 138}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200747545_1200747550 12 Left 1200747545 Y:6915792-6915814 CCAGTTTTCTGCTGGGAGTCCGG 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1200747550 Y:6915827-6915849 TGCTCCGAAGCAGTGCCCGTGGG 0: 1
1: 0
2: 0
3: 2
4: 38
1200747545_1200747552 19 Left 1200747545 Y:6915792-6915814 CCAGTTTTCTGCTGGGAGTCCGG 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1200747552 Y:6915834-6915856 AAGCAGTGCCCGTGGGCCTCCGG 0: 1
1: 0
2: 0
3: 16
4: 153
1200747545_1200747553 20 Left 1200747545 Y:6915792-6915814 CCAGTTTTCTGCTGGGAGTCCGG 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1200747553 Y:6915835-6915857 AGCAGTGCCCGTGGGCCTCCGGG 0: 1
1: 0
2: 0
3: 24
4: 201
1200747545_1200747549 11 Left 1200747545 Y:6915792-6915814 CCAGTTTTCTGCTGGGAGTCCGG 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1200747549 Y:6915826-6915848 TTGCTCCGAAGCAGTGCCCGTGG 0: 1
1: 0
2: 0
3: 2
4: 45
1200747545_1200747554 25 Left 1200747545 Y:6915792-6915814 CCAGTTTTCTGCTGGGAGTCCGG 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1200747554 Y:6915840-6915862 TGCCCGTGGGCCTCCGGGCCTGG 0: 1
1: 0
2: 1
3: 24
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200747545 Original CRISPR CCGGACTCCCAGCAGAAAAC TGG (reversed) Intronic
900968957 1:5978724-5978746 CAGGGCTCCCAGCAGCCAACAGG + Intronic
901536259 1:9884425-9884447 CAGGCCTCCCAACAGAAATCAGG + Intronic
904672253 1:32174652-32174674 CCAGACTCTCAGCTGAAGACAGG + Exonic
907660669 1:56389988-56390010 TCAAACTCCCAGGAGAAAACAGG + Intergenic
908259289 1:62327245-62327267 CCGGACTACCAGCTGCAGACAGG - Intergenic
911110652 1:94180945-94180967 CAGGACTCTCAGCTGAAAAATGG - Intronic
912491826 1:110066685-110066707 CTGGACTCCAGGCAGAAAAGGGG + Intronic
913059134 1:115188766-115188788 CCTGACTGCCAGCTGAAAACAGG + Intergenic
913544291 1:119851934-119851956 CCTGTCTCCCATCAGAAAAATGG - Intergenic
913602493 1:120435415-120435437 CCTGTCTCCCATCAGAAAAATGG + Intergenic
913991689 1:143618845-143618867 CCTGTCTCCCATCAGAAAAATGG - Intergenic
914084554 1:144441092-144441114 CCTGTCTCCCATCAGAAAAATGG - Intronic
914190567 1:145406358-145406380 CCTGTCTCCCATCAGAAAAATGG - Intergenic
914363665 1:146959047-146959069 CCTGTCTCCCATCAGAAAAATGG + Intronic
914488010 1:148128079-148128101 CCTGTCTCCCATCAGAAAAATGG - Intronic
914588373 1:149083232-149083254 CCTGTCTCCCATCAGAAAAATGG - Intronic
917028602 1:170666560-170666582 CTGGACCCACAACAGAAAACAGG + Intronic
921161408 1:212474820-212474842 CAGGACTCCAAGCAGAAAGGGGG + Intergenic
922207984 1:223465739-223465761 CCTGACTCCCAGGAGGAAAAAGG - Intergenic
922209245 1:223474910-223474932 CCTGCCTCCCAGCAGAAGCCTGG + Intergenic
1064285855 10:13990650-13990672 CCGGACTCTGAGCAGAACAATGG + Intronic
1065129383 10:22605047-22605069 CCTGAGTTCCAGCTGAAAACAGG - Intronic
1067656560 10:48196543-48196565 CCAGCCTCCCTGCAGGAAACTGG - Intronic
1068458487 10:57292959-57292981 ATGAACTCCCAGCAGACAACTGG - Intergenic
1070597673 10:77844127-77844149 CTGGACTCCCAGTAGAAAGCAGG - Intronic
1073088617 10:100913029-100913051 CCGGAGTCCCAGCAGCAAGACGG + Exonic
1075955377 10:126518886-126518908 CCGCCCTCCAGGCAGAAAACCGG - Intronic
1076601945 10:131663039-131663061 CTGGACACCCAGCAGGACACAGG + Intergenic
1080281755 11:30565280-30565302 CCGGATGCCAAGTAGAAAACCGG - Intronic
1088748461 11:112823994-112824016 AGGGATTCTCAGCAGAAAACGGG + Intergenic
1089677389 11:120098948-120098970 CCCCACTCCCAGCAGCTAACAGG - Intergenic
1091220651 11:133928245-133928267 CCGGTCTCCCAGCAGCCACCGGG + Intronic
1095161606 12:38924004-38924026 CCTGACTCTCAACAGGAAACAGG - Intergenic
1095207959 12:39459985-39460007 CTGGACACCAAGTAGAAAACAGG - Intergenic
1101647533 12:106645128-106645150 GGCAACTCCCAGCAGAAAACAGG + Intronic
1103007207 12:117430823-117430845 CCAGACTCTCAGAAGAAAAATGG - Intronic
1105502961 13:20988626-20988648 CGGGACTCCCTGCAGAAGCCGGG - Exonic
1116102859 14:40464492-40464514 CCCAACTCCCAACAGCAAACGGG - Intergenic
1116409701 14:44607026-44607048 CCAGACTCACAGCATAAAACTGG - Intergenic
1117641748 14:57807409-57807431 CCTGCCTCCAAGCAGGAAACAGG + Intronic
1120954568 14:90070411-90070433 CCCTGCTCCCAGCAGAAAAATGG - Intronic
1124959586 15:34384463-34384485 CCCCACCCCCAGCAGAAAAATGG - Intronic
1124976212 15:34530684-34530706 CCCCACCCCCAGCAGAAAAATGG - Intronic
1127428389 15:58878231-58878253 CCAGATTCCCATCTGAAAACTGG + Intronic
1128277979 15:66370246-66370268 CCTGACTCCCACCAAAAAACAGG + Intronic
1129178451 15:73856724-73856746 CCCATCTCCCAGCAGGAAACAGG + Intergenic
1133169284 16:3971078-3971100 CCAGACTTCCAGCAGGAAAGCGG - Intronic
1137562731 16:49513284-49513306 CTGGTCTCCCAGCAGAAGTCAGG + Intronic
1146800002 17:35810591-35810613 CTGTATTTCCAGCAGAAAACTGG - Intronic
1149211161 17:54303104-54303126 CTGGACTCCCAGCATAGACCTGG - Intergenic
1151209461 17:72533538-72533560 CCGGTAGCCCAGCAGAAAAGAGG + Intergenic
1151433902 17:74082381-74082403 TCAGAGTCCAAGCAGAAAACAGG + Intergenic
1151554551 17:74840072-74840094 CCTGGCTCCCTGCAGAAAGCTGG + Intergenic
1155369045 18:25078848-25078870 CTGGGCTCCCAGCAGAAAGTGGG + Intronic
1155661230 18:28250524-28250546 TCAGAGTCCCAGCAGAAAACAGG - Intergenic
1156445365 18:37232782-37232804 CCAGACTTCCAGCAGAGGACAGG + Intergenic
1156586185 18:38433689-38433711 CCGGGCTCCCAGGAGGAAAAGGG + Intergenic
1156878180 18:42042092-42042114 CCAGACTCCCAGAAGGAAAGTGG - Intronic
1160012374 18:75115860-75115882 CCTGGCTCCCAGCAGACCACCGG + Intergenic
1161492204 19:4568142-4568164 CCACACTCCCAGCAGCACACGGG - Intergenic
1161790712 19:6358144-6358166 CCTGACTCACAGCAGAAACTGGG + Intergenic
1167430829 19:49453474-49453496 CGGGACTCCCCGCGAAAAACCGG - Intronic
932571049 2:72938564-72938586 CAGGAGTCCCAGCAGGAAACTGG - Intergenic
936349396 2:111701502-111701524 CCGAAGTCCCAGCTGATAACTGG + Intergenic
943393039 2:187294674-187294696 CGTGCCTCCAAGCAGAAAACTGG - Intergenic
944931143 2:204520940-204520962 TGGGAGGCCCAGCAGAAAACTGG - Intergenic
946255479 2:218438714-218438736 CCGGACTCACAGCAGTGATCTGG - Exonic
946658543 2:221975440-221975462 CCTGACCACCAGCAGAAAAGGGG + Intergenic
947520610 2:230843313-230843335 TCGGTTTCCCAGCATAAAACTGG - Intergenic
948805630 2:240452587-240452609 CCGGACTGCCCGCGGAGAACAGG + Intronic
948873197 2:240813816-240813838 CAGAGCTGCCAGCAGAAAACAGG + Intronic
1172521258 20:35567591-35567613 TCAAACTCACAGCAGAAAACAGG + Intergenic
1173331714 20:42080751-42080773 CCTGACTCCAAGGAGAAGACTGG - Exonic
1173358812 20:42320965-42320987 ACGGACACACAGCAGAAAAGGGG + Intronic
1175285740 20:57835666-57835688 CGGGCCTCCCAGCAGCAATCAGG - Intergenic
1175647158 20:60684550-60684572 GAGGCCTCCCAGCAGCAAACAGG - Intergenic
1179056901 21:37944724-37944746 CCAGACTCCCTGTAGACAACGGG - Intergenic
1179292477 21:40030711-40030733 CTGGATTTCCAGCAGAAATCAGG - Intronic
1181007305 22:20020045-20020067 CCTGATGCCCTGCAGAAAACTGG - Intronic
1181698922 22:24609073-24609095 CCGGACTCCCAGCTGGGACCCGG + Intronic
1182440877 22:30363094-30363116 CCTGACTCCCAGCAGAATGCTGG + Intronic
1182651045 22:31851516-31851538 ACTGGCTCCCAGCAGAATACTGG - Intronic
950405298 3:12800524-12800546 GCGGAGTCTCAGGAGAAAACAGG - Intronic
953212283 3:40886759-40886781 CTGGATTGCCAGCAGGAAACTGG - Intergenic
956891059 3:73614490-73614512 TGGGACTCACAGCAGAGAACTGG + Intronic
957772337 3:84710457-84710479 ACGGAAGCCCAGCAGAAAAAGGG - Intergenic
958731966 3:97969595-97969617 CCAGACTCCCAGAGGAAAGCAGG - Intronic
960310556 3:116111278-116111300 CCGGACTGCCAGAATCAAACAGG + Intronic
964961583 3:162434604-162434626 ACGGCCTCCAAGCAGAAAAAAGG + Intergenic
965293223 3:166909988-166910010 CTGGATTCCAAGCACAAAACTGG - Intergenic
967420458 3:189266487-189266509 CCCTATTCCCACCAGAAAACTGG - Intronic
968377064 4:52461-52483 CCTTACTTCCAGCAGAAAAGAGG + Intergenic
968457765 4:707538-707560 CCCGACCCCCAGGGGAAAACAGG - Intronic
968457804 4:707646-707668 CCCGACCCCCAGGGGAAAACAGG - Intronic
968457867 4:707826-707848 CCCGACCCCCAGGGGAAAACAGG - Intronic
968457882 4:707862-707884 CCCGACCCCCAGGTGAAAACAGG - Intronic
968457893 4:707898-707920 CCCGACCCCCAGGGGAAAACAGG - Intronic
968457924 4:707970-707992 CCCGACCCCCAGGGGAAAACAGG - Intronic
968866711 4:3217563-3217585 CAGCAATCCCAGCAGAAAATGGG + Intronic
969838659 4:9864267-9864289 CCAGCCTTCCAGAAGAAAACTGG - Intronic
975542691 4:75531181-75531203 CCAGACTCCCAGAAGGAAACTGG - Intronic
986260417 5:6140765-6140787 TAGGACACCCAGAAGAAAACAGG + Intergenic
987022535 5:13889613-13889635 CCAGACTCCCAGAAGGAATCAGG - Intronic
990654063 5:57935122-57935144 CCAGACTCCCAGAAGGAAGCAGG - Intergenic
991361849 5:65828953-65828975 CCAGATACCCACCAGAAAACCGG - Exonic
996047955 5:118897412-118897434 TCAGACTCCCAGAAGAAAACTGG + Intronic
1000242837 5:159424593-159424615 CTGGACTTCCTACAGAAAACAGG - Intergenic
1002689758 5:181042517-181042539 GCGGACGCACAGCAGCAAACGGG + Intronic
1003426873 6:6003543-6003565 CAGGACTCCCTGCAGAGAGCAGG + Intronic
1004310636 6:14541845-14541867 CAGGACTCTCAGCAGAATCCTGG - Intergenic
1005679242 6:28189218-28189240 TCTGACTTCCAGCAGAAAGCTGG - Intergenic
1012071327 6:94621078-94621100 CAGTTTTCCCAGCAGAAAACAGG - Intergenic
1017819557 6:158039477-158039499 CCAGAATCCCAGCAGATCACTGG - Intronic
1019558204 7:1642813-1642835 ACGGACTCCCGGCAGACATCAGG + Intergenic
1020472633 7:8556421-8556443 CTGAACTCCCAGTAGACAACCGG - Intronic
1020773396 7:12424124-12424146 CCTGCCTGCCAGCAGAAAGCTGG + Intergenic
1025194688 7:56923743-56923765 CCCTACTCCCAGCAGGACACTGG - Intergenic
1025677264 7:63653200-63653222 CCCTACTCCCAGCAGGACACTGG + Intergenic
1026538659 7:71261473-71261495 CCTGACTCCCAGGAGAACCCGGG - Intronic
1027319037 7:77000980-77001002 CCGGGCTCCCAGCTAAAATCAGG - Intergenic
1029201233 7:98840479-98840501 CCCAATGCCCAGCAGAAAACAGG + Intergenic
1029539256 7:101173212-101173234 CCCCACCCCCAGCAGAACACGGG - Intronic
1030806779 7:113929513-113929535 CCGGAGGCCCAGGAGAAAAGTGG + Intronic
1034237947 7:149587214-149587236 CCGGTCTCCCAGCTGAAAATAGG - Intergenic
1034240971 7:149610582-149610604 CCAGTCTCCCAGCTGAAAATAGG - Intergenic
1034912574 7:155009469-155009491 GGGGAGTCCCAGCAGAAAGCTGG + Intergenic
1035206189 7:157295381-157295403 CAGGGCTCCCAGAAGAAAGCAGG - Intergenic
1035208691 7:157311742-157311764 CTGCACTCCCAGCAGAGACCAGG + Intergenic
1036387678 8:8296148-8296170 CTCCACTCCCAGCAGAGAACAGG - Intergenic
1037458216 8:19084167-19084189 CCTGAATCCCAGCAGAAGAAAGG - Intronic
1041452815 8:58025312-58025334 CCAGACTCACAGCAGGAGACAGG + Intronic
1044948639 8:97414601-97414623 GCCGAAGCCCAGCAGAAAACTGG - Intergenic
1049254443 8:141606244-141606266 CCAGCCTCCCAGCAGACAACTGG + Intergenic
1053123780 9:35563722-35563744 CCCTACTCCCAGCAGCAAGCGGG + Intronic
1054853751 9:69875608-69875630 CAGGAACCCCAGCAGAACACTGG - Intronic
1054855929 9:69899698-69899720 TCAGACTCCCAGAAGGAAACAGG - Intronic
1058212619 9:102189016-102189038 CAGGACTCCCAGCATGGAACGGG - Intergenic
1059028949 9:110668508-110668530 CCGGACTCAAACCAGAAATCTGG - Intergenic
1059267889 9:113052724-113052746 CCAGACTCCCAGAAGAAAGCAGG + Intronic
1061010834 9:127953721-127953743 CCGCACCCCCAGCTGAAAATGGG - Intronic
1203572173 Un_KI270744v1:141785-141807 CCTTACTTCCAGCAGAAAAGAGG - Intergenic
1185581163 X:1212581-1212603 CCAGCCTCCCAGCAGAAAGACGG + Exonic
1186426566 X:9467342-9467364 CTGGACGCCCTGCAGAAAACTGG - Intronic
1188228320 X:27629308-27629330 CAGAACTCCTAGAAGAAAACAGG - Intronic
1190301199 X:49058630-49058652 CCGTACACTTAGCAGAAAACTGG - Intronic
1191970334 X:66807279-66807301 CAAAACTCCCAGAAGAAAACAGG - Intergenic
1194986066 X:100490986-100491008 TCAGGATCCCAGCAGAAAACAGG + Intergenic
1195842713 X:109192054-109192076 CTGGATTTCAAGCAGAAAACTGG + Intergenic
1196686197 X:118512679-118512701 CTGGGCTCCCAACAGAAATCTGG - Intronic
1200252095 X:154559199-154559221 CCCGACTCCCAGCAGCAGAGCGG + Intronic
1200265673 X:154645217-154645239 CCCGACTCCCAGCAGCAGAGCGG - Intergenic
1200747545 Y:6915792-6915814 CCGGACTCCCAGCAGAAAACTGG - Intronic