ID: 1200749253

View in Genome Browser
Species Human (GRCh38)
Location Y:6929618-6929640
Sequence TAGTGTTCCCATCAGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200749253_1200749258 0 Left 1200749253 Y:6929618-6929640 CCCAGCTCCTGATGGGAACACTA 0: 1
1: 0
2: 1
3: 8
4: 122
Right 1200749258 Y:6929641-6929663 TGGAGTGTGCGGCCTCAGCCAGG 0: 1
1: 0
2: 2
3: 9
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200749253 Original CRISPR TAGTGTTCCCATCAGGAGCT GGG (reversed) Intronic
901218016 1:7565484-7565506 GAGTGTCCACATCAGGGGCTGGG + Intronic
904129242 1:28263337-28263359 TTGTCTGCCCATCATGAGCTGGG - Intronic
904937614 1:34142627-34142649 TAGTGTTCCACTCAGCAGCATGG + Intronic
905918405 1:41701647-41701669 TACAGTTACCATCAGGAGTTTGG - Intronic
908662009 1:66446907-66446929 AAATGTCCACATCAGGAGCTTGG - Intergenic
909689156 1:78387076-78387098 TAGTGTTTGCGTCAGGAGCTAGG + Intronic
913204008 1:116518782-116518804 TAGGGTTCACTTCAGGAGCCAGG - Intronic
918753055 1:188298017-188298039 TTGTGTTCTCACCTGGAGCTTGG + Intergenic
918780044 1:188687969-188687991 GAGTCTTCCCAACAGCAGCTTGG + Intergenic
922246713 1:223806118-223806140 TACTGTCCCCTTCTGGAGCTTGG - Intronic
923233352 1:232009108-232009130 TATTGTTCCCATTTGGAGCATGG - Intronic
1075814734 10:125256299-125256321 TAGGGTTCCCATCTGGGGCGTGG - Intergenic
1075886535 10:125904369-125904391 CAGTGATGCCATCAGGAACTTGG - Intronic
1076095479 10:127732141-127732163 CTGTGTTCTCATCTGGAGCTTGG + Intergenic
1078010485 11:7569687-7569709 CAGTGTTACCCTCAGGAGATGGG + Intronic
1078175416 11:8965889-8965911 TACTGTTCCCAACAGGAACCAGG + Intergenic
1078869396 11:15329576-15329598 TAGTGTTCTCATCAGGCCCCAGG + Intergenic
1079351585 11:19696262-19696284 CAGTGTTCCCATCTGGAATTAGG + Intronic
1079476396 11:20834248-20834270 TGGTGTGCACATCAGGTGCTGGG + Intronic
1082654494 11:55836843-55836865 AAATGTTCCCATCAGGAGAAGGG - Intergenic
1083039302 11:59670173-59670195 TAGTGTTACCATCATGAGGCAGG - Intergenic
1089161740 11:116443362-116443384 CAGTGTTCTCGTCTGGAGCTTGG - Intergenic
1095323391 12:40858055-40858077 CTGTGTTCCCTTCTGGAGCTTGG + Intronic
1096545741 12:52338965-52338987 TGGTGTTCCCACCAAGAGCAAGG - Intergenic
1102355132 12:112227569-112227591 TAGTTTTCCCATCATCAGTTTGG + Intronic
1106252614 13:27994203-27994225 TCGTGTGACCACCAGGAGCTGGG + Intergenic
1109947226 13:69452171-69452193 TAGTTTTCCCATCTAGAGATGGG - Intergenic
1111562328 13:89967469-89967491 AAGTCTTGCCTTCAGGAGCTGGG - Intergenic
1117992764 14:61450995-61451017 TAGTGTTCCCATGAAGAGGTGGG - Intronic
1118628108 14:67677131-67677153 TAGTGTTCCCATCACTTGTTTGG - Exonic
1120167653 14:81219197-81219219 TTTTGTTCCCAGCAGCAGCTAGG - Intronic
1120215958 14:81680903-81680925 TAGTTTTACCATCTGGAGCAAGG - Intergenic
1122392624 14:101400433-101400455 TAGCCTTTCCATCAGGAGCAGGG - Intergenic
1202871551 14_GL000225v1_random:169566-169588 CAGTGATGCCATCAGGAACTGGG + Intergenic
1124407085 15:29402931-29402953 TAATGTTCCCATCAGCAGGCGGG + Intronic
1129206822 15:74042183-74042205 CAGTGTTCCCACCAGGACCTTGG + Intronic
1131087860 15:89592061-89592083 GAGTGGGCCCAGCAGGAGCTTGG + Exonic
1133343421 16:5054146-5054168 TAGTGTCCTCATTAGAAGCTTGG - Intronic
1136186701 16:28592618-28592640 CTGTGATCCCATCATGAGCTGGG + Intronic
1136189328 16:28606412-28606434 CTGTGATCCCATCATGAGCTGGG + Intronic
1136541774 16:30931335-30931357 TCATGTTCCCATCAGTTGCTGGG + Intronic
1137383637 16:48021823-48021845 TAGTGTGCAGATGAGGAGCTGGG + Intergenic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1142987249 17:3703618-3703640 CACTGTTCCCAGCAGCAGCTTGG + Intergenic
1143463326 17:7118222-7118244 TCGTGTTCCCATGTGGACCTAGG + Intergenic
1143944412 17:10577714-10577736 TAGTATCCCCAGCAGGATCTGGG + Intergenic
1144678227 17:17175408-17175430 TAGAGGTACCATCAGGAGCCAGG + Exonic
1147388957 17:40097797-40097819 TAGTGTTAAAATCAGCAGCTGGG - Intronic
1149108580 17:52998113-52998135 TTCTGTACCCATCTGGAGCTTGG + Intergenic
1149217996 17:54380753-54380775 TAGTGTTCCTCTCAGGAGCAAGG + Intergenic
1151741567 17:75986246-75986268 GCGTGCTCCCATCAGGAACTTGG - Exonic
1153531447 18:6050801-6050823 TATTTTTCCCATTATGAGCTGGG - Intronic
1156470023 18:37371652-37371674 TGGTCTTGCCACCAGGAGCTGGG + Intronic
1156851653 18:41735159-41735181 GAGTGTTCCCTTCATGAGTTAGG + Intergenic
1157283487 18:46361221-46361243 TTGTTTTCCCATCTGGAGCTGGG - Intronic
1163673960 19:18646023-18646045 AAGTCTTCCTAGCAGGAGCTGGG - Intronic
1165925436 19:39323194-39323216 TAGTGCTCCCTGCTGGAGCTTGG + Intergenic
1166687500 19:44804409-44804431 TACTCTTTCCATCAAGAGCTGGG - Intergenic
1168315793 19:55484267-55484289 AAGTGGTCCCCGCAGGAGCTGGG + Exonic
1168438148 19:56338757-56338779 TAGGGTACCCAACAGGACCTTGG + Intronic
927050649 2:19324889-19324911 TAGAGTCCCCATCAGGATCCAGG - Intergenic
931103069 2:59024468-59024490 TTGTATTCCCCTCAGGACCTTGG + Intergenic
931122419 2:59234610-59234632 TATTGTTCCCATGATGTGCTGGG + Intergenic
931403336 2:61952145-61952167 AATTCTTCCCATCATGAGCTTGG - Intronic
935683911 2:105666967-105666989 TGCAGTTCTCATCAGGAGCTTGG + Intergenic
942804622 2:179915634-179915656 CAGTTTTCCCATCAGCAGCACGG - Intergenic
946084419 2:217156661-217156683 TCTTGTTCTCATCAGGTGCTTGG - Intergenic
947619326 2:231578626-231578648 ACGTGTTCACATCTGGAGCTGGG + Intergenic
1168945450 20:1751643-1751665 TAGAATTCCCTTAAGGAGCTTGG - Intergenic
1169950775 20:11040976-11040998 AAGTGTTCCAATCAGTATCTGGG - Intergenic
1170060463 20:12253599-12253621 TTGTGTTCCATTCTGGAGCTTGG + Intergenic
1172223353 20:33288515-33288537 TCGTTTTCACATCAGGAGCGAGG - Intronic
1173239743 20:41283851-41283873 TACTGTTCCTAAGAGGAGCTGGG - Intronic
1173551936 20:43938480-43938502 TAGTGCACCCATCAGGACATGGG - Intronic
1175227226 20:57451620-57451642 GATTGTCCCCATCTGGAGCTTGG - Intergenic
1180878698 22:19188125-19188147 TAGTGTCCCCATAACAAGCTTGG - Intronic
1182314263 22:29433456-29433478 CAGTTTTCCCAGCAGGAGATGGG - Intergenic
1184400685 22:44272152-44272174 AACTGCTCCCATTAGGAGCTTGG - Intronic
1184742937 22:46439618-46439640 TAGTTTGCCCACCAGGAGCTGGG - Intronic
1185302032 22:50086736-50086758 TAGTGTTGCCAACAGAAACTTGG - Intergenic
955789507 3:62573666-62573688 GAGTTTTCCCATGAGGAGCAGGG - Intronic
957934861 3:86929187-86929209 TAGGGTACCCAGCAGTAGCTGGG + Intergenic
959588458 3:108049181-108049203 TGCTTTTCCAATCAGGAGCTTGG - Intronic
964985804 3:162736516-162736538 CTGTGTTCTCATCTGGAGCTTGG - Intergenic
969247177 4:5943089-5943111 TAGTGTTCCAGGCAGGATCTTGG + Intronic
969412968 4:7042010-7042032 CAGTGGTACCACCAGGAGCTGGG - Exonic
969840174 4:9875786-9875808 AAATGTCCCAATCAGGAGCTTGG - Intronic
971819771 4:31536866-31536888 TATTCTTCCCATCAGGACATGGG - Intergenic
977657065 4:99534901-99534923 TAGTGCTTCCTTCAGGAGCAAGG + Intronic
980202266 4:129670907-129670929 TAGTGGTCACCTCAGGAGGTTGG + Intergenic
981797092 4:148607854-148607876 TAGTGTTCCCAACAGGAGGAAGG - Intergenic
983165003 4:164464719-164464741 TAGTGTTTCCATAAGAAGATGGG - Intergenic
984474234 4:180216264-180216286 AAGTCTTCCCATCAGGACTTCGG - Intergenic
987897471 5:23965985-23966007 TGGTGTTCTCACGAGGAGCTTGG - Intronic
990942299 5:61214907-61214929 TGGTGTTCTTATCTGGAGCTTGG + Intergenic
1002679353 5:180949043-180949065 CAGAGTTCCCATCACAAGCTTGG - Intronic
1002685231 5:181004540-181004562 CAGAGTTCCCATCACAAGCTTGG - Intronic
1005120817 6:22388126-22388148 TAGTGCTTCCTTCAGGAGCAAGG + Intergenic
1007325536 6:41056715-41056737 TTGAGTACCTATCAGGAGCTAGG - Intronic
1009887181 6:69638022-69638044 CAGTGTCCTCATCAGGACCTTGG + Intergenic
1011627732 6:89296990-89297012 TAGTGATGCTATCAGGAGCCTGG - Intronic
1017648011 6:156556753-156556775 TAGTGTCCCCCTCAGGAAATGGG + Intergenic
1020726340 7:11820086-11820108 TTGTGTTCCGCTCAAGAGCTGGG + Intronic
1021713309 7:23438078-23438100 TAGTGTTTCCTCCAGGAGATTGG - Intronic
1023526882 7:41113762-41113784 TAGTGTTCCCATCTTTATCTAGG + Intergenic
1027216295 7:76185953-76185975 TAGGGTTTGCAGCAGGAGCTGGG - Intergenic
1029118072 7:98248155-98248177 GACTGTTCCTATCAGGAGCCAGG - Intronic
1029218931 7:98972730-98972752 TTCTGTTCATATCAGGAGCTAGG + Intronic
1031273020 7:119678572-119678594 TACTGTGCCCTTCAGGAGCCAGG - Intergenic
1031808232 7:126333525-126333547 TGGTGATGCCATCAGGAGTTAGG - Intergenic
1034368237 7:150570387-150570409 TAGTGAGACCACCAGGAGCTGGG - Intronic
1036792449 8:11730502-11730524 TACTGTTCTGGTCAGGAGCTGGG + Intronic
1039506234 8:38054539-38054561 AAGTGGTCCCATCTGGAGCCAGG + Intronic
1039786146 8:40835740-40835762 TAGTTTTCCCTGCAGCAGCTTGG - Intronic
1051001821 9:12291306-12291328 TAGAGTTCTCATAAGGATCTAGG - Intergenic
1053167635 9:35855727-35855749 TTCTGTTCCCTTCAGGACCTAGG + Intergenic
1053426555 9:38014033-38014055 TAGTGTTTGCATCAGATGCTGGG - Intronic
1055379258 9:75688530-75688552 TTGTGTTCCCATTAGCAGATGGG + Intergenic
1056469799 9:86894289-86894311 CAGCGTTCCCAAAAGGAGCTGGG - Intergenic
1056698377 9:88879981-88880003 TTGTCTTCCCACAAGGAGCTGGG + Intergenic
1057496334 9:95564275-95564297 TAGTGTGGCCAAAAGGAGCTGGG - Intergenic
1203732897 Un_GL000216v2:107033-107055 CAGTGATGCCATCAGGAACTGGG - Intergenic
1185578665 X:1193479-1193501 TAAAGTTCCCATCAGGAGGCCGG + Intronic
1186025411 X:5305599-5305621 TCGTTTTCCTAACAGGAGCTAGG + Intergenic
1186300059 X:8190892-8190914 AAGTCTTCCAATTAGGAGCTAGG + Intergenic
1194545338 X:95226649-95226671 TAGTGCTTCCTTCAGGAGCCTGG - Intergenic
1195102520 X:101568818-101568840 TAGTGCTTCCTTCAGGAGCTTGG - Intergenic
1195479117 X:105322437-105322459 TTGTGTTCCCATCTGGAGCTTGG + Intronic
1197303398 X:124809330-124809352 TAGTGAACCCATCAGGTCCTGGG - Intronic
1200729385 Y:6716852-6716874 TACTGTTCCCACAAGGAGGTGGG - Intergenic
1200749253 Y:6929618-6929640 TAGTGTTCCCATCAGGAGCTGGG - Intronic
1202628053 Y:56880637-56880659 CAGTGATGCCATCAGGAACTGGG + Intergenic