ID: 1200750806

View in Genome Browser
Species Human (GRCh38)
Location Y:6942552-6942574
Sequence GAGGAGACCTAGAGTTATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 2, 1: 0, 2: 0, 3: 12, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200750801_1200750806 22 Left 1200750801 Y:6942507-6942529 CCTAAGAGATCCTGAAGAGTGAG 0: 2
1: 0
2: 3
3: 20
4: 218
Right 1200750806 Y:6942552-6942574 GAGGAGACCTAGAGTTATCAGGG 0: 2
1: 0
2: 0
3: 12
4: 98
1200750802_1200750806 12 Left 1200750802 Y:6942517-6942539 CCTGAAGAGTGAGCAGAGATTGA 0: 2
1: 0
2: 5
3: 18
4: 225
Right 1200750806 Y:6942552-6942574 GAGGAGACCTAGAGTTATCAGGG 0: 2
1: 0
2: 0
3: 12
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200750806 Original CRISPR GAGGAGACCTAGAGTTATCA GGG Intronic
901268450 1:7931114-7931136 GATGATACCAAGAGTTATCAGGG + Intronic
910568293 1:88670738-88670760 GAGGAAACCGAGACTTAGCAGGG - Intergenic
911689485 1:100816248-100816270 GAGGAGTCTTAGGGTTTTCAAGG - Intergenic
911729698 1:101280038-101280060 GAGGAGAGCTTGAGTTGGCAGGG + Intergenic
914955063 1:152154661-152154683 GAGGAGAAAGAGAGGTATCAAGG - Exonic
915063663 1:153207193-153207215 GAGGAGACCTTGAGGTCTCAGGG + Intergenic
920979876 1:210823121-210823143 GAGGTGGCCCAGAGTTACCATGG - Intronic
921183276 1:212648087-212648109 GATGAGAACTATAGTTCTCATGG + Intergenic
923911370 1:238447838-238447860 GAGGGACCCTAGAGTTAACAAGG - Intergenic
924932760 1:248745413-248745435 GAGGAGACATGGTGTTTTCAAGG - Intronic
1065316256 10:24466489-24466511 GAGGAGAAATTGACTTATCACGG + Intronic
1068539178 10:58272004-58272026 AATGAGTGCTAGAGTTATCAAGG - Intronic
1074733328 10:116400915-116400937 GATGATACCAAGAGTTTTCAAGG + Intergenic
1076610448 10:131722895-131722917 AAAGAGACCTTGAGTGATCACGG + Intergenic
1079466384 11:20735021-20735043 GAGGAGGCCTAGACTGATCCCGG + Intronic
1079823900 11:25166196-25166218 GAGGAGAACAAGAGACATCAGGG - Intergenic
1080679623 11:34461869-34461891 GAGGGGAGCTAGAATTAGCAGGG + Intronic
1082138547 11:48579219-48579241 GAGGAGAAGTAGAATTGTCAAGG + Intergenic
1082568183 11:54706667-54706689 GAGGAGAAATAGAATCATCAGGG + Intergenic
1082612481 11:55318343-55318365 GAGGAGAAATAGAATTGTCAAGG + Intergenic
1082621601 11:55430253-55430275 GAGGAGAAATAGAATTGTCAAGG + Intergenic
1082624485 11:55466563-55466585 GAGGAGAAATAGATTTGTCAAGG + Intergenic
1083852340 11:65375666-65375688 GAGGAGACATAGGGTTATCCTGG + Exonic
1085514677 11:77105324-77105346 GAGGAGGCCTGGAATAATCAGGG + Intronic
1089710308 11:120309811-120309833 ACAGAGACCTAGAGTTGTCAGGG + Intronic
1094436121 12:30422655-30422677 TAGGAGACCTGGAATCATCAGGG - Intergenic
1096070276 12:48771589-48771611 GATGGGACCCAGAGTCATCAGGG - Intronic
1100138808 12:91590726-91590748 GCGGAGACCTAGAGAGAGCAAGG + Intergenic
1100617595 12:96242963-96242985 GAGGACACCAAGAGTTTTCTGGG - Intronic
1103971881 12:124677659-124677681 GAGGAGACCTGGAGGTCTCAGGG + Intergenic
1104760593 12:131295595-131295617 GAAGAGACCTTGAAGTATCAGGG + Intergenic
1104819182 12:131665190-131665212 GAAGAGACCTTGAAGTATCAGGG - Intergenic
1106769565 13:32948773-32948795 AAGGACACCTAGAGCCATCAAGG - Intergenic
1108322873 13:49304218-49304240 GTGGAGACCTAGACTGAGCATGG + Intergenic
1109225176 13:59685080-59685102 CAGGGCACCTAGAGTTATCAAGG + Intronic
1109233119 13:59783224-59783246 GAGGAGACATAGAGAAATCTTGG + Intronic
1111019274 13:82425493-82425515 GAGGTTACTCAGAGTTATCATGG - Intergenic
1112120999 13:96411337-96411359 GAGGAGCCAGAGAGTTCTCATGG + Intronic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1116950262 14:50872432-50872454 AAAGAGCCCTAGAGTTCTCAGGG - Intronic
1117981644 14:61347859-61347881 GAGAAGACCCAGAGTTTTCAGGG + Intronic
1118818050 14:69326557-69326579 GAGGAGAGCTGGAGTGAGCAGGG + Intronic
1127919423 15:63481573-63481595 GAGGAGACCCAAAGTTATGCAGG - Intergenic
1129858149 15:78839813-78839835 GAGAACACCTGGAGTTATTAAGG + Intronic
1130044002 15:80430088-80430110 GAGAAGACCTAGAGTGACCTAGG - Intronic
1132076210 15:98823115-98823137 GAGGAGACCTGGAGAAATAAAGG - Intronic
1137910991 16:52378299-52378321 GAAGAGACCTAGAGTAACAATGG + Intergenic
1143300947 17:5910324-5910346 GATGAGACCTTGAGATATCCTGG - Intronic
1144105481 17:11981174-11981196 GAGGAGACCTAGAATAATTGTGG - Intronic
1147129332 17:38397456-38397478 AAGGGGACCTAGAGGTATAAAGG - Intronic
1147129403 17:38397976-38397998 AAGGGGACCTAGAGGTATAAAGG + Intronic
1147391430 17:40111755-40111777 GAGGACACCTTGGGTCATCAGGG - Intergenic
1148103350 17:45106126-45106148 GAGGAGACATTGGCTTATCATGG + Exonic
1163890555 19:20008611-20008633 CAGGAGACCCATATTTATCAGGG - Intronic
1165776904 19:38410022-38410044 GAGGAGACCAAGAGATGTCTAGG + Exonic
1166646974 19:44539376-44539398 GAGCAAACCTCGTGTTATCATGG + Intergenic
934665282 2:96165068-96165090 GAGGAGATCTTGAGTTCTCCAGG + Intergenic
937351924 2:121171234-121171256 GAGGAGACCTAGAGAGACCCTGG - Intergenic
945747479 2:213736162-213736184 AAAGAAACCTTGAGTTATCATGG - Intronic
948452161 2:238082472-238082494 GAGGAGACGTCGAGATCTCAGGG + Intronic
1170418428 20:16168912-16168934 AAGGAGGCCGAGAGCTATCAAGG + Intergenic
1173161819 20:40658514-40658536 GAGGAGACCTAGAGACAAAAAGG + Intergenic
1175805161 20:61823560-61823582 GAGGAGACCAAGAATTAAGAAGG + Intronic
1182906917 22:33946064-33946086 CAGGAGAACTAGAGATAGCAAGG - Intergenic
958087971 3:88837114-88837136 GAGGAGTCTTAGGGTTTTCAAGG + Intergenic
962166878 3:133058628-133058650 GAGGAGACCAAGAGGTGCCAAGG + Intronic
965736701 3:171828033-171828055 GTATAGACTTAGAGTTATCACGG - Intergenic
969935457 4:10675477-10675499 GTGGAGAACAAGAGTTCTCAAGG - Intronic
970500122 4:16668403-16668425 GAAGAGACTGAGAGCTATCACGG - Intronic
973821492 4:54665599-54665621 AAGGAGAACTGGAATTATCATGG + Intronic
978289171 4:107117110-107117132 GAAGGGACTTTGAGTTATCAGGG - Intronic
986670280 5:10137537-10137559 AAGGAAACCTAGAGAAATCAGGG - Intergenic
988125276 5:27024886-27024908 TAGGAGACATAGAGTTAGCACGG + Intronic
988855709 5:35226371-35226393 GAAGAAACCAAGAGTCATCAAGG - Intronic
989000744 5:36757640-36757662 GATGAGACCTATAGCTATGAGGG + Intergenic
989588989 5:43096037-43096059 GAGCAAACCTAGAGGTGTCATGG + Intronic
991933274 5:71777063-71777085 GAGGAGACATAGAGGTGTCCTGG + Intergenic
992214323 5:74510517-74510539 GAGGAGAAAGAGAGTTATTAGGG - Intergenic
994377744 5:99034335-99034357 GAGGAGAACAAGAGATACCAAGG - Intergenic
997372366 5:133370177-133370199 GATGAGACCCAGAGTTCTCCAGG + Intronic
1003070047 6:2938727-2938749 GAAGACACCTGGAGTTAGCAAGG + Intergenic
1004899373 6:20180310-20180332 GAGGACATCAAGAGCTATCAGGG - Intronic
1005590871 6:27325404-27325426 GAGGAAACCTTGAGTAAACATGG - Intergenic
1007850867 6:44801586-44801608 AGGGAGACCCAGAGTTAACAAGG + Intergenic
1011730811 6:90261392-90261414 AAGGAGAGCAAGAGTTGTCAAGG - Intronic
1013718218 6:112989705-112989727 GAAGAGACCAAGAATAATCATGG - Intergenic
1014972505 6:127835098-127835120 GAAGACACATAGAGGTATCAGGG + Intronic
1017233193 6:152094311-152094333 TAGGAGACCCAGAGTGTTCATGG - Intronic
1026775327 7:73227504-73227526 GAGGAGACCCAGAGTGTTCAGGG + Intergenic
1027016184 7:74780875-74780897 GAGGAGACCCAGAGTGTTCAGGG + Intronic
1027071844 7:75165062-75165084 GAGGAGACCCAGAGTGTTCAGGG - Intergenic
1028154978 7:87419570-87419592 GAGGATACCTACAGTTAGTATGG + Intronic
1035068748 7:156125840-156125862 GAGCTGCCCTAGAGTTCTCAGGG - Intergenic
1036086641 8:5619711-5619733 GAGCAGACCTAGTGTTTTCCAGG + Intergenic
1038366894 8:26945524-26945546 GAGGAAAGCTAGGGTTTTCAAGG + Intergenic
1039458456 8:37724126-37724148 GAGGAGGGCTGGAGTAATCAGGG - Intergenic
1041675982 8:60540347-60540369 GATGAGAGCTGGAATTATCAGGG + Intronic
1043988931 8:86728696-86728718 GAGGGGATCTGGAGTTATCATGG + Intronic
1044434962 8:92151025-92151047 GAGGAGAATGAGAGGTATCAGGG + Intergenic
1048248623 8:132837839-132837861 GAGGAGACATAGAGGCATCCTGG - Intronic
1049302796 8:141880457-141880479 GGGGAGACGTAGAGGCATCACGG - Intergenic
1051840948 9:21397444-21397466 GAAGAGACCTCAGGTTATCATGG - Intergenic
1052450738 9:28627540-28627562 GATGAGACCTATAGTGATCTTGG - Intronic
1057388822 9:94626411-94626433 GAGGAGACCTGGAGACATGAGGG - Intronic
1186432965 X:9520524-9520546 GAGGAGACCTAGAGTTATCAGGG + Intronic
1188113724 X:26220120-26220142 GAGGTGACCTCTAGTTCTCATGG - Intergenic
1193162061 X:78239634-78239656 GAAGAGTCCTAGAGTCATCATGG + Intergenic
1194784807 X:98069644-98069666 GAGAAGATCTAGAGTGAACAGGG + Intergenic
1196856717 X:119991311-119991333 GAGGAGACAGAGAGAGATCAGGG - Intergenic
1197979269 X:132198508-132198530 TGGGAGACCTGGAGTTAGCAGGG - Intergenic
1200750806 Y:6942552-6942574 GAGGAGACCTAGAGTTATCAGGG + Intronic
1202064045 Y:20918644-20918666 GCTGAGACTTAGAGTTATGAAGG + Intergenic