ID: 1200750967

View in Genome Browser
Species Human (GRCh38)
Location Y:6943829-6943851
Sequence TCATTGCCACAGCTGGCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200750963_1200750967 8 Left 1200750963 Y:6943798-6943820 CCATATGGAAATATTTTGTATCT 0: 1
1: 0
2: 5
3: 45
4: 427
Right 1200750967 Y:6943829-6943851 TCATTGCCACAGCTGGCTAAGGG 0: 1
1: 0
2: 1
3: 16
4: 188
1200750960_1200750967 25 Left 1200750960 Y:6943781-6943803 CCCAGTAGAACTTTCTACCATAT 0: 1
1: 0
2: 0
3: 13
4: 151
Right 1200750967 Y:6943829-6943851 TCATTGCCACAGCTGGCTAAGGG 0: 1
1: 0
2: 1
3: 16
4: 188
1200750961_1200750967 24 Left 1200750961 Y:6943782-6943804 CCAGTAGAACTTTCTACCATATG 0: 1
1: 0
2: 1
3: 10
4: 134
Right 1200750967 Y:6943829-6943851 TCATTGCCACAGCTGGCTAAGGG 0: 1
1: 0
2: 1
3: 16
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200750967 Original CRISPR TCATTGCCACAGCTGGCTAA GGG Intronic
900724195 1:4204367-4204389 TCACTGCAACAGCTTCCTAATGG - Intergenic
900737654 1:4309177-4309199 ACATTGCCACAGGTGGCCAGGGG - Intergenic
901838316 1:11938336-11938358 TCATTGCCAGAGCTGGTTGGAGG + Intronic
902249578 1:15145348-15145370 TGATTGTCACAGCTGGGGAAAGG + Intergenic
902342067 1:15790350-15790372 GCACTACCACAGCTGGCTAATGG - Intergenic
903247155 1:22024549-22024571 TCAATGACACAGCCGGCTAGAGG - Intergenic
905311252 1:37050580-37050602 ACATTGCCAAATCTGGCTAGGGG + Intergenic
909241299 1:73217367-73217389 CCATTGCCACTGCTGTCAAAAGG + Intergenic
910671994 1:89783091-89783113 TTATTTCCAAAGTTGGCTAAGGG + Intronic
911117473 1:94260704-94260726 TCATGGCCTCAGCTCACTAATGG - Intronic
913663913 1:121030235-121030257 TCTTTGCCAAAACTGGTTAAAGG - Intergenic
914015307 1:143813514-143813536 TCTTTGCCAAAACTGGTTAAAGG - Intergenic
914162511 1:145147711-145147733 TCTTTGCCAAAACTGGTTAAAGG + Intergenic
914653925 1:149722055-149722077 TCTTTGCCAAAACTGGTTAAAGG - Intergenic
914685599 1:149976144-149976166 TAATTGTCACACCTTGCTAAGGG + Intronic
915546636 1:156602629-156602651 TCACTCCCACAGCGGGCTGAAGG - Intergenic
916778926 1:168001667-168001689 TCTTTGCCACAGCATGCTAAAGG - Intronic
917615589 1:176740699-176740721 TCATAGCCACATCTGTCTAGAGG - Intronic
920217461 1:204371115-204371137 TCATTGCCACATGTGGCTCATGG + Intronic
922371963 1:224920220-224920242 TTATTTCCACAGCTGGCATAGGG + Intronic
922609908 1:226918792-226918814 ACATAGCCACAGCTGGCTGCAGG - Intronic
1062788783 10:287900-287922 ACATGGCCACACCTAGCTAAAGG - Intronic
1063281186 10:4631272-4631294 TCGTTTCCTTAGCTGGCTAATGG + Intergenic
1063695428 10:8330662-8330684 TCATACCCACAGTGGGCTAATGG + Intergenic
1064513926 10:16125476-16125498 CCATTGCCAAAGCAGCCTAATGG - Intergenic
1065877752 10:30011887-30011909 TCAATGTCACAGCTAGTTAATGG + Intergenic
1066213227 10:33260489-33260511 TCTCTGCCTCAGCTGGCAAAAGG - Intronic
1067924713 10:50496605-50496627 ACATGGCCAGAGCTGCCTAATGG + Intronic
1070577286 10:77688782-77688804 CCATGGCCACAGGTGGCTAGTGG - Intergenic
1071977241 10:90967421-90967443 ACACTACCACAGCAGGCTAATGG - Intergenic
1073769681 10:106722537-106722559 TCATTTTCACAGTTGGTTAAAGG + Intronic
1074055802 10:109922480-109922502 CCGTTGCCACAGCTTGTTAAGGG - Intronic
1074214931 10:111374972-111374994 TCATTGGCACAGGTGGCAAAAGG - Intergenic
1078957255 11:16213563-16213585 TCATCTCCACTGATGGCTAATGG - Intronic
1079008906 11:16812407-16812429 TCAGACCCACAGCTGACTAAAGG + Intronic
1082708462 11:56522270-56522292 TGATTGCCACAGATGGCTGCAGG + Intergenic
1083238667 11:61369484-61369506 CTTTTGCCAAAGCTGGCTAAGGG - Exonic
1084298016 11:68225786-68225808 GCATTGCAGCAGCTGGCCAATGG + Intergenic
1084724277 11:70930572-70930594 TCACTGCCACATCTGGGTAGAGG + Intronic
1084998077 11:73003238-73003260 TCATTTCCTCAACTGGCAAATGG + Intronic
1085181866 11:74543057-74543079 TCATTGCCAGGGGTGGCCAAAGG - Intronic
1087017449 11:93567690-93567712 TCATTGCCAGAGCTGGATTTTGG + Intergenic
1087464187 11:98484694-98484716 TCATTGGCACTTCTGGTTAATGG - Intergenic
1088652839 11:111973560-111973582 TGATAGCTACAGGTGGCTAATGG + Intronic
1089803460 11:121059418-121059440 TCATAGCCACACATAGCTAATGG - Intronic
1089935060 11:122356125-122356147 TCAGTGTCACAGCTGGTAAATGG + Intergenic
1090420337 11:126571036-126571058 TGAGTCCCACAGCTGGCAAATGG + Intronic
1091470125 12:719264-719286 TTATTTCCAAAGCTGGCTTAGGG + Intergenic
1096428656 12:51525145-51525167 CCATAGCCACATGTGGCTAATGG + Intergenic
1100063552 12:90611541-90611563 TCCTTGTCACAGCTTGCTCATGG - Intergenic
1100582770 12:95950783-95950805 TCATAGCCACACCTGGCTAGTGG + Intronic
1101269062 12:103123608-103123630 CAATAGCCACAGGTGGCTAATGG - Intergenic
1101658031 12:106741485-106741507 TAATAGCCACAGGTGGCTAATGG - Intronic
1102296900 12:111744204-111744226 GCAATGCCACAACTGACTAAAGG - Intronic
1102313457 12:111865893-111865915 TAATGGCCTCAGCTGGCTATAGG - Intronic
1103013835 12:117478787-117478809 ACATAGCCACATCTGGCTAGTGG + Intronic
1107651999 13:42554193-42554215 CCATAGCCACACATGGCTAATGG + Intergenic
1108517959 13:51220874-51220896 TCATTGGCATAGCAGTCTAATGG - Intergenic
1110114784 13:71799520-71799542 TCATTGCCCCATGTGGCAAATGG - Intronic
1110132054 13:72021498-72021520 TCATTGCCAGGGGTGGCCAAAGG - Intergenic
1111255660 13:85664145-85664167 TCAATGTCACAGATGTCTAAAGG - Intergenic
1111284349 13:86068517-86068539 CATTTGCCACATCTGGCTAATGG + Intergenic
1112045235 13:95590011-95590033 TCATTGCCACAGCAGCATAGGGG - Intronic
1113074012 13:106450571-106450593 GCACTGCCACTGCTGGGTAACGG - Intergenic
1115008314 14:28512915-28512937 TAATAGCCACAGGTGGCTAGTGG + Intergenic
1117117076 14:52525135-52525157 TCATTGCAACTGCTGCCTCATGG + Intronic
1118143477 14:63110677-63110699 TCATAGCCACAGCTGGTTAGTGG - Intergenic
1122125630 14:99577016-99577038 TCAGTCCCACAGCTGGCTGGAGG + Intronic
1123717326 15:23041565-23041587 TCATAACCACAGCTGGCCATAGG + Intergenic
1123717891 15:23043454-23043476 TCATAACCACAGCTGGCCAGAGG + Intergenic
1123718638 15:23046076-23046098 TCATAACCACACCTGGCTAGAGG + Intergenic
1123719076 15:23047597-23047619 TCATAACCACAGCTGGCCATAGG + Intergenic
1123719367 15:23048602-23048624 TCATAACCACAGCTGGCCATAGG + Intergenic
1124824558 15:33081010-33081032 TTATTGCCACATCTGGTAAATGG - Intronic
1125161461 15:36649303-36649325 TCTTTGCCAGAGTTGGCTGAGGG - Intronic
1126779835 15:52129968-52129990 ACATGGCCACATCTGGCTACAGG - Intronic
1127494068 15:59493133-59493155 TCATTGCCACCTCAGGCTGACGG - Intronic
1127712230 15:61610984-61611006 ACATTGCCACAGCTGGCCTCTGG - Intergenic
1128897102 15:71384913-71384935 TCATTGGCTAAGCTGGTTAAGGG - Intronic
1130055548 15:80521798-80521820 TCATTGCCTCCGCTGGGTAATGG + Intronic
1135170821 16:20181725-20181747 TCTTTGTCTCAGCTGGCTAAGGG + Intergenic
1136297241 16:29310562-29310584 TCATGGCAAGAGCTGTCTAAAGG - Intergenic
1136990076 16:35146667-35146689 TCTGTGCCACCCCTGGCTAAGGG + Intergenic
1142628572 17:1208343-1208365 TCAATTCCTCAGCTGGCCAAGGG - Intronic
1143518669 17:7432975-7432997 TAATAGCCACATTTGGCTAATGG - Intergenic
1143979485 17:10856015-10856037 TCATAGCCACATGTGGCTAGTGG - Intergenic
1145236165 17:21209801-21209823 TCAGAGCCACACGTGGCTAATGG + Intronic
1147500905 17:40962816-40962838 TCATTTCCAGGGCTGGATAATGG + Intronic
1148704057 17:49612396-49612418 TCATTATCACAACTGACTAAAGG - Intronic
1149544906 17:57496291-57496313 ACATAGCCACAGATGGCCAAAGG - Intronic
1150879684 17:69009814-69009836 TCATCTTCATAGCTGGCTAATGG - Intronic
1153134992 18:1906541-1906563 TCATTTCCTCACCTGGCAAATGG + Intergenic
1156336376 18:36176196-36176218 TCATAGCCACATGTGGCTCATGG + Intronic
1157686082 18:49643961-49643983 TCATTGCCAGAGCTGGGGGAGGG - Intergenic
1158687621 18:59628977-59628999 TCACTGCCACAGCCTCCTAAGGG + Intronic
1158983267 18:62786903-62786925 TAATTGAAAAAGCTGGCTAAAGG + Intronic
1159975694 18:74708909-74708931 GCATTGCCTCAGCAGGCTTAGGG + Intronic
1164388196 19:27794528-27794550 TCTGTGCCACCCCTGGCTAAGGG + Intergenic
926390210 2:12382439-12382461 TAATAGCCACATGTGGCTAATGG + Intergenic
930746246 2:54886086-54886108 TCATTGTCACAGTTGGGTGATGG - Intronic
931989425 2:67775070-67775092 TAACAGCCACAGATGGCTAATGG + Intergenic
933428209 2:82140361-82140383 TTATTGCTACAGCTGGTTACAGG - Intergenic
933784255 2:85826485-85826507 TCATTGCAACCTCTGCCTAACGG + Intergenic
935558671 2:104538420-104538442 TTTTTGCTACAGCTTGCTAAGGG - Intergenic
936471032 2:112798750-112798772 GCATCACCACATCTGGCTAATGG - Intergenic
936653517 2:114457344-114457366 TCATTGTCACAGCTGGGGAAGGG - Intronic
940799285 2:158115569-158115591 ACATTCCCAAAGCTGGGTAAGGG - Intronic
941513362 2:166441255-166441277 TAATGGCCACATCTGGCTAGTGG + Intronic
946278054 2:218645486-218645508 CCTATGGCACAGCTGGCTAAGGG - Intronic
1171090462 20:22280733-22280755 TCATTGTCCCTCCTGGCTAATGG - Intergenic
1172186934 20:33036730-33036752 TCAGTGCCCCAGCTGGCTTCTGG + Intronic
1173310569 20:41892891-41892913 TCAGTACCACAGATGGCTTATGG - Intergenic
1174704513 20:52641745-52641767 AAATTGCCACAGCTTGCTAATGG + Intergenic
1177878077 21:26659399-26659421 ACATGCCCACAGCTGACTAAGGG + Intergenic
1178918296 21:36721949-36721971 TCATTTCCACAGCCGGCCGAGGG + Intronic
1180069873 21:45430928-45430950 TCAATGGCCCAGCTGACTAAGGG - Intronic
1181339097 22:22164411-22164433 TCATTGCTAGGGCTGGCTAGAGG + Intergenic
1182680014 22:32071604-32071626 ACTTTGCAACTGCTGGCTAAGGG - Intronic
1183155045 22:36068202-36068224 TCACTGCCACCTCTGCCTAATGG - Intergenic
949448628 3:4162444-4162466 GCCTTGCCACTGCTGGGTAAAGG - Intronic
952403627 3:32986113-32986135 TAATTGCCAAAGCAGGCAAAAGG - Intergenic
956050813 3:65246239-65246261 GACTTGCCACAGCTGGCTTAGGG + Intergenic
956388822 3:68749869-68749891 CCATAGCCACGGGTGGCTAATGG + Intronic
956630331 3:71310891-71310913 TCATGGCCACATCTGGCTCTTGG + Intronic
961390998 3:126552369-126552391 TCATGGCCACAGCAGCCAAACGG + Intronic
961919284 3:130409009-130409031 TAATAGCCACATATGGCTAATGG + Intronic
962038878 3:131683790-131683812 TCTTTGCCACTGCAGGCTGAAGG - Intronic
962459735 3:135599137-135599159 CAATAGCCACAGGTGGCTAATGG - Intergenic
964628991 3:158788664-158788686 TCTTAGCCACCCCTGGCTAAGGG + Intronic
965392969 3:168128186-168128208 TCATAGCAACAGGTGGCTTATGG - Intergenic
965833014 3:172817116-172817138 TCATAGCCACAAGTGGCTAGTGG + Intronic
969036659 4:4259343-4259365 TCATGGCCACAGATGCCAAAAGG + Intergenic
969278998 4:6156798-6156820 TCATGGCCACACCTGGCACATGG + Intronic
969296850 4:6275387-6275409 TCTCTGCCACAGCTGACTAAGGG + Intronic
970069985 4:12147364-12147386 TCATGGCCATATGTGGCTAATGG + Intergenic
971250338 4:24968947-24968969 TCATTGCCAGTGGTGGCCAAAGG - Intronic
971259777 4:25045568-25045590 TCACAGCCACCACTGGCTAATGG + Intergenic
973576728 4:52297172-52297194 TGATTGTCACAGCTGGCCATGGG - Intergenic
975317985 4:72977459-72977481 TCAATTCCCCAGCTGGCGAATGG + Intergenic
976564818 4:86541163-86541185 ACAATGCGACAGCTGGCTTATGG + Intronic
978439877 4:108722213-108722235 TTGTTGCCACAGATGGTTAAGGG - Intergenic
980812892 4:137905622-137905644 TCTTTGCCAAAGCTCTCTAATGG - Intergenic
980995991 4:139780156-139780178 TCATAGCCACACTTGGCTAGTGG + Intronic
981124517 4:141090653-141090675 TCATGGCCTCAGATGGCTACAGG + Intronic
982360614 4:154515286-154515308 TAATAGCCACATGTGGCTAATGG - Intergenic
984371815 4:178876741-178876763 TCATTTCCTCAGCTAGCAAATGG - Intergenic
988182238 5:27811486-27811508 TCACTGCCACATCTGCCTCACGG - Intergenic
988611898 5:32734725-32734747 TCAATGCCACATGTGGCTAGTGG - Intronic
990572486 5:57093334-57093356 TCAGTGCCAAAGCTGGGAAAGGG + Intergenic
992891634 5:81209596-81209618 TCAGTGCCGCTGCTGCCTAAAGG + Intronic
994293867 5:98065289-98065311 CCAGTGCCACATGTGGCTAATGG - Intergenic
995577484 5:113555771-113555793 TCTCTGCCACAGCTGGATAATGG - Intronic
999902205 5:156096522-156096544 TCATTGCCCCATCTGGTGAATGG + Intronic
999920365 5:156311989-156312011 TCCATGCCATAGCTAGCTAAGGG + Intronic
1000005268 5:157177197-157177219 TAATTGCTAAAGCTGGCTAATGG - Intronic
1000090584 5:157926414-157926436 TCATTGCCCCAGCTCTCTGAAGG - Intergenic
1000410986 5:160934884-160934906 TCATTGCCAGGGGTGGCCAAAGG + Intergenic
1000822569 5:166002634-166002656 CATTTTCCACAGCTGGCTAAGGG + Intergenic
1002362507 5:178684011-178684033 TAATCGCCACAGCTGGCTCGTGG - Intergenic
1003589105 6:7422125-7422147 TAATTGCTAAAGCTGGGTAATGG + Intergenic
1006007966 6:31017820-31017842 GGATTGCCACTGCTGGCTCAGGG - Intronic
1011631693 6:89332543-89332565 CCATAGCCACATGTGGCTAATGG - Intronic
1012292443 6:97473981-97474003 AGATTCCCACAGCTGGCTAGCGG - Intergenic
1012416989 6:99022470-99022492 TCATTGCCAGCGGTGGCCAAAGG + Intergenic
1014752658 6:125271719-125271741 TCATTGCCAAAGGTGGCCAAAGG - Intronic
1017033404 6:150244598-150244620 CCATAGCCACAGATGGCTAGTGG - Intronic
1017697406 6:157030919-157030941 TTCTTTCCACTGCTGGCTAACGG + Intronic
1019136677 6:169912917-169912939 TGATTCCCACAGCAGGTTAAGGG + Intergenic
1019463105 7:1171865-1171887 ACGTTGCCACTGCTGGCTAGAGG - Intergenic
1020408031 7:7858815-7858837 TCATTTCCACCTCTAGCTAATGG + Intronic
1021197948 7:17693283-17693305 TGGTTGCCACAGCTGGGAAAAGG - Intergenic
1021668954 7:23015553-23015575 TGATAGCCACATGTGGCTAATGG - Intergenic
1022200419 7:28111257-28111279 TCCTTGCCACATCTGGTTATAGG + Intronic
1023398080 7:39770429-39770451 TGAGTGCCACACCTGGCTGAGGG - Intergenic
1023533761 7:41186438-41186460 TCATTCACACATCTGGCAAATGG + Intergenic
1024646895 7:51378447-51378469 GCACTACCACAGCTGGTTAATGG + Intergenic
1027462319 7:78470028-78470050 TGATTTCCACAGCAGGCTTAGGG - Intronic
1028180216 7:87711741-87711763 CCATTGCCACATGTAGCTAATGG + Intronic
1028184073 7:87760199-87760221 TGAATGCCACATGTGGCTAATGG - Intronic
1028494012 7:91444078-91444100 TCTCAGCCACAGCTGGCTCATGG - Intergenic
1031873406 7:127111562-127111584 TCATAGCCTAAGATGGCTAATGG - Intronic
1035291998 7:157845230-157845252 TTTTTCCTACAGCTGGCTAAGGG - Intronic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1043673130 8:82913944-82913966 TCATTGACACATCTTGCAAAAGG + Intergenic
1044846699 8:96389036-96389058 CCATGGCCACAGCTGGAAAAAGG - Intergenic
1046941780 8:119938660-119938682 GCATTACCACACCTGGCTAATGG + Intronic
1047314543 8:123720405-123720427 CCATTGCCACTGTTGGTTAATGG + Intronic
1048517941 8:135127420-135127442 GCATTTCCACAGCTTGCTGAGGG + Intergenic
1051975054 9:22939116-22939138 TCATTACCCTAGCTGGCAAATGG + Intergenic
1052730840 9:32283403-32283425 TCATCTGCACAGCTGGCTACAGG - Intergenic
1059245763 9:112848519-112848541 TCAAGGCCACACCTGGCTCATGG - Intronic
1060092869 9:120760008-120760030 ACACTGCCAAAGATGGCTAATGG + Exonic
1061503407 9:131016655-131016677 TCAGTGCAACAGCTGACAAAGGG + Intronic
1061907046 9:133704166-133704188 TGAGAGCCAGAGCTGGCTAACGG - Intronic
1062547052 9:137068587-137068609 TGATTGACACAGCTGGCTTTTGG - Intronic
1187475160 X:19604090-19604112 TCATTGTTACAGAAGGCTAACGG - Intronic
1188039737 X:25357971-25357993 TCTTTCCCACACCTTGCTAAAGG + Intergenic
1188605307 X:32021574-32021596 CAATAGCCACAGGTGGCTAATGG - Intronic
1189618033 X:42804794-42804816 TCATTACCAGATCTGGATAAAGG + Intergenic
1194751536 X:97690186-97690208 TCACTGCCACATGTGGCTATGGG + Intergenic
1196736413 X:118984570-118984592 TCATTTCCACAGCTGCCTAATGG + Intronic
1197459083 X:126716672-126716694 AAATAGCCACAACTGGCTAATGG - Intergenic
1199533008 X:148870915-148870937 CCATTCCCAGACCTGGCTAAAGG - Intronic
1200288754 X:154850585-154850607 ACACTACCACACCTGGCTAAGGG + Intronic
1200750967 Y:6943829-6943851 TCATTGCCACAGCTGGCTAAGGG + Intronic
1200837556 Y:7748150-7748172 TGATAGCCACATATGGCTAATGG - Intergenic